Supplementary Methods and Materials
Modelling Disrupted-in-Schizophrenia 1 loss of function in human neural progenitor cells: tools for molecular studies of human neurodevelopment and neuropsychiatric disorders.
Nao R. Kobayashi1,3, Ph.D., Lin Sui1, M.Sc., Pauline S.L. Tan1, B.Sc., Edwin K.H. Lim1, B.Sc., Jerry Chan2, M.D., Ph.D., Mahesh Choolani2, M.D., Ph.D. and Jeremy Micah Crook1,3*, Ph.D.
1 Institute of Medical Biology, A*STAR, Singapore
2 Departments of Obstetrics and Gynaecology, National University of Singapore, Singapore
3 O’Brien Institute and University of Melbourne, Victoria, Australia
* Corresponding author: Jeremy Micah Crook, Ph.D. Director of Stem Cell Medicine
O’Brien Institute
42 Fitzroy Street, Melbourne
VIC 3065 Australia
Tel: +61 3 9288 4281
Fax: +61 3 9416 0926
Email:
Acknowledgements
This study was supported by the Agency for Science, Technology and Research (A*STAR), Helen Macpherson Smith Trust and O’Brien Foundation. We thank Dr. Jinqiu Zhang for her valuable advice to generate the lentiviral vector and Mr. Thong Teck Tan, Ms. Rachel Han, Ms. Denise Leong, Mr. Adam Mathews and Ms. Tracey Lomas for their excellent technical support.
Supplementary Methods and Materials
Isolation of human brain derived NPCs
14-21 week foetal human brain tissues were procured following donor consent with the approval of the Singapore National Healthcare Group Domain Specific Review Board (ref: D/06/154). The hippocampus (HP) and subventricular zone (SVZ) were carefully dissected from brain tissue, digested with a mixture of 14 U/ml of papain (Fluka) and 0.01% DNAse (Sigma-Aldrich) diluted in DMEM/F12 (Invitrogen) for 40-60 minutes at 37 °C. Tissues were then rinsed with DMEM/F12 and gently triturated 30-40 times. Cells were seeded at a density of 2-3 x 106 into a low attachment T-75 flask (Corning) in serum-free expansion medium containing DMEM/F12 or neurobasal (Invitrogen) medium supplemented with 2% B27 (Invitrogen), 2 µg/ml heparin (Sigma), epidermal growth factor (EGF, 10 ng/ml; Peprotech) and basic fibroblast growth factor (bFGF, 20 ng/ml; Peprotech). In 7-14 days, neural progenitor cells (NPCs) formed free-floating neurospheres and were passaged every 5 -7 days thereafter by digesting in 1-2 ml TrypLE (Gibco BRL) for 5 minutes at 37°C, triturating into single cells, and plating at a density of 55,000 cells/ml into ultra-low attachment 6-well plates (Corning). RenCell CX (Millipore) was also cultured as neurospheres in serum-free DMEM/F12 based expansion medium as above.
Differentiation of human ES cells to NPCs
For standard feeder-based human ES cell culture, the cGMP-derived ES cell line ESI-049 was grown on gamma-irradiated human foreskin fibroblasts (3 × 105 cells/cm2 ; Ortec International) as described previouslyS1. ES cell medium comprised KO-DMEM, 1% KO-SR (all reagents from Invitrogen) supplemented with 50 ng/ml cGMP-grade bFGF (Strathman). For passaging, ES cells were dissociated with 1.25 mg/ml of collagenase NB6 (Serva), scored using a 2 ml glass pipette, harvested with a cell scraper, and transferred to fresh feeder plates.
Differentiation of ES cells to NPCs was based on the protocol described by Nat et al. with modificationsS2. Briefly, ES cells were cultured for 1 day in neural induction medium (NIM), comprising DMEM/F12:Neurobasal (1:1; Gibco) supplemented with 1x N2 supplement (100x stock, Gibco), 1x B27 supplement (50x stock, Gibco) and 2 mM Glutamax (Gibco). The following day, ES cell colonies were passaged and seeded onto poly-ornithine (20µg/cm2) / laminin-coated (15 µg/cm2) tissue culture plates. Culture plates were prepared by coating with poly-ornithine for 1 hour at room temperature (RT), followed by laminin coating overnight at 4 0C. Most of the cell clusters adhered on the second day after seeding. Adherent cultures were grown in NIM for further 3 days and then in neural proliferation media (NPM) comprising DMEM/F12:Neurobasal (1:1) supplemented with 0.5% N2 supplement, 0.5% B27 supplement, 2 mM Glutamax and 50 ng/mL FGF2 (Miltenyi Biotec) for up to 21 days. NPM was changed every second day. From day 14 of NPM-based culture, white colonies with homogenous morphology and a delicate sponge-like texture were isolated from the cultures using a sterile needle and transferred as free-floating aggregates (similar to neurospheres) to low-attachment culture plates in serum-free expansion medium. Expansion medium comprised of DMEM/F12 supplemented with 1% B27, 2 µg/ml heparin, 20 ng/ml bFGF (Peprotech) and 10 ng/ml EGF (Peprotech). Neurospheres were sectioned into halves or quarters every 2-3 days using sterile needles and dissociated to single cells by TrypLE digestion for 3 min at 370C, re-seeded at a density of 20,000 cells/cm2 to ultra-low attachment plates, and passaged every 5-7 days thereafter.
Differentiation of human NPCs
For differentiation of human NPCs, neurospheres were enzymatically triturated as above and 40,000 – 75,000 cells/cm2 were plated onto 20 mg/ml laminin (Simga) and 0.1 % poly-L-lysine (Sigma) coated 8-well-chamber slides (Nunc) in DMEM/F12 differentiation medium supplemented with 1% B27, 0.5% N2 (Gibco) and 50 ng/ml brain-derived neurotrophic factor (BDNF) (Peprotech) for 14-28 days. A half-volume medium change was performed every 2-3 days.
Lentiviral vector generation and transduction of NPCs
The generation of transgenic cell lines was performed in accordance with the Singapore Biosafety Guidelines for Research on Genetically Modified Organisms, and approved by the Genetic Modification Advisory Committee and Biosafety Branch of the Ministry of Health. Plentilox(pLL)3.7 backbone (Figure 1e, modified from http://www.sciencegateway.org/protocols/lentivirus/pllmap.html; Addgene) was double digested with XhoI and HpaI. The following human Disrupted-In-Schizophrenia 1 (DISC1) 19mer sequences were cloned into the multiple cloning sites: 5’-GCCTTTACCTCAAGCTTTA-3’ (exon2, shRNA1) and 5’-GCTGAGACGTTACAACAAA-3’ (exon 5, shRNA2). Control shRNA 5’-GAACGGCAUCAAGGUGAACTT-3’ was previously describedS3. 293FT packaging cells were cultured according to the manufacture’s recommendation (Invitrogen). At 80-90% confluency, 293 FT cells grown in a T-75 flask were co-transfected with 12 mg of pLL3.7 shRNA1, shRNA2 or control and 9 mg of pMDL-RRE (Addgene), 4.5 mg of pVSVG (Addgene) and 4.5 mg of pRSV-REV (Addgene) using 67.5 ml of Lipofectamin 2000 (Invitrogen) diluted in 5 ml of opti-MEM medium (Invitrogen). A complete medium change was performed after 24 hours. Three days after transfection, medium containing viral particles was transferred to a fresh 50 ml tube and centrifuged at 2000 rpm for 7 minutes. Supernatant was filtered through 0.45 mm filter (Whatman) into a Beckman open top ultracentrifuge tube and centrifuged at 25,000 rpm for 2 hours at 8°C. Supernatant was carefully removed and a pellet was resuspended in 200 ml of DMEM/F12 medium overnight at 4°C. The lentiviral stock was frozen in a 20 ml aliquot and stored at -80°C until use.
Titration of concentrated pLL3.7 lentiviral stocks (i.e. shRNA1, shRNA2 or control) was performed by serial dilution (10-150 fold) in a total volume of 100 ml DMEM-F12 medium (Gibco). Neurospheres were digested with TrypLE as above, and 0.5 x 106 single cells in 300 ml of DMEM-F12 medium were inoculated with serially diluted viral stocks in a 15 ml falcon tube for 3 hours at 37 °C, 5% CO2 in a humidified atmosphere with agitation every 20-30 minutes. Cells were then inoculated at 85,000 cells/ml in the DMEM-F12 expansion medium onto an ultra low attachment 6-well plate (Corning). After 24 hours, the viral containing medium was replaced with the fresh DMEM-F12 expansion medium. Transduced neurospheres were collected at 72 hours when GFP expression reached maximum and were digested with TrypLE as above. Single cells were fixed with BD Cytofix/Cytoperm solution (BD BioScience), washed 2-3 times with BD Perm/Wash Buffer (BD Bioscience) and analysed by flow cytometry. Viral titre was based on GFP-positive cells between 1-30% using the formula derived from White et al.S4 and Sastry et al.S5. Optimum titre was determined each time when fresh viral stocks were made and chosen to generate 70-80% GFP-positive cells.
Immunocytochemistry
Neurospheres were cytospun onto Shandon double cytoslides (Thermo Scientific) using a Cytospin 4 Cytocentrifuge (Thermo Scientific) at 600rpm for 3 minutes. Cells were fixed with 4% paraformaldehyde (PFA, Sigma), washed with 0.1% Triton-X100 (Bio-Rad) / PBS, and treated with 5% goat serum in 0.3% (v/v) Triton-X100/PBS for at least 1 hour at RT. Cells were incubated with the following primary antibodies at 4°C overnight: mouse anti-Ki67 (1:500, BD Bioscience), mouse anti-nestin (1:500, BD Bioscience) rabbit anti-Sox2 (1:500, Chemicon,) and chicken anti-vimentin (1:1000, Chemicon). For differentiated NPCs, cultured cells were fixed, washed and permeabilised as above and incubated with the following primary antibodies: mouse or rabbit anti-bIII-tubulin (1:2000, Babco Covance), mouse anti-microtubule associate protein (MAP)-2 (1:1000, Sigma) mouse anti-prox1 (1:100, Chemicon), rabbit anti-GABA (1:5000, Sigma), mouse anti-Calbindin-d28k (1:250, Swant), mouse anti-vesicular glutamate transporter (NeuroMab). After washing with PBS, appropriate secondary antibodies conjugated with Alexa Fluor 488 or 555 (1:500, Invitrogen) were applied for 1 hour at RT. Cell nuclei were counter stained with Hoechst 33342 before coverslipping with FluorSave mouting medium (Calbiochem).
Flow Cytometry and Fluorescent Activated Cell Sorting (FACS)
Neurospheres were collected and digested in TrypLE as described above. After trituration, single cells were pelleted and fixed with BD Cytofix/Cytoperm solution on ice for 15 minutes. After 2 to 3 washes in BD Perm/Wash buffer, cells were incubated with primary antibodies (anti-Ki67, anti-nestin, anti-sox2 and anti-vimentin as above) diluted in wash buffer on ice for 1 hour. Following a further 2-3 washes, a secondary antibody conjugated with Alexa Fluor-488 was applied for 30 minutes on ice. Cells were then washed again before being resuspended in 1% FBS/PBS and analysed by a BD FACSCalibur system (BD Biosciences). Transduced GFP-expressing human ES cell derived NPCs (shRNA1 or shRNA-control) were sorted after TrypLE dissociation (as above) using a FACSAria (BD Biosciences).
Quantitative real time (qRT)-PCR
Total RNA was extracted using an RNeasy kit or Allprep DNA/RNA/Protein kit (Qiagen) according to the manufacture’s protocol. The total RNA fraction (1-4 µg) was reverse transcribed to cDNA by a thermocycler (Eppendorf Mastercycler) using 3 mg/ml random primers (Invitrogen), 10 mM dNTP (Invitrogen), 10x Reverse Transcriptase (RT) NEBuffer (Qiagen), and M-MuLV RT (Qiagen) according to the manufacturer’s protocol. qRT-PCR was carried out using a iQ5 Multi-colour Detection System (BioRad) or 7500 Fast Real-Time PCR system (Applied Biosystems) using specific primers (Supplementary table 1) and SYBR Green SuperMix (BioRad) or Taqman probes (β-actin, GAPDH, and DISC1; Applied Biosynthesis) according to the manufacturer’s recommendation. Data was analysed using BioRad iQ5 software or 7500 Fast Real Time PCR system software v2.0.1. All data was normalized against shRNA control (% of control expression), with β-actin or GAPDH as a reference gene. Statistical analyses were performed using a non-parametric t-test or non-parametric ANOVA followed by post hoc Turkey’s test (GraphPad Prism).
Migration assay
Cell migration assay was performed according to the manufacture’s protocol (Platypus Technologies; Supplementary Figure 1g). Briefly, a plate was coated with laminin (20 mg/ml) and 0.1% poly-L-lysine for 2 hours at RT. After 3 washes with culture-grade water, dissociated NPCs transduced with DISC1 targeting shRNA or control shRNA were seeded at a density of 50,000 cells/well with a stopper to allow cells to attach overnight. 6 days after removal of the stopper from each well, NPCs were fixed with 4 % PFA and processed for immunocytochemistry for GFP. An entire well of immunostained cells was scanned using Cellomics Arrayscan VTI (Thermo Scientific) with or without a detection mask. The percentage of GFP positive cells was based on the total number of GFP positive cells in a well divided by the number of GFP positive cells in the migration zone. Statistical analyses were performed using a non-parametric ANOVA followed by post hoc Dunnett’s multiple comparison test (GraphPad Prism).
References
S1. Crook JM, Peura TT, Kravets L, Bosman AG, Buzzard JJ, Horne R et al. The Generation of Six Clinical-Grade Human Embryonic Stem Cell Lines. Cell Stem Cell 2007 Nov 15; 1(5): 490-494.
S2. Nat R, Nilbratt M, Narkilahti S, Winblad B, Hovatta O, Nordberg A. Neurogenic neuroepithelial and radial glial cells generated from six human embryonic stem cell lines in serum-free suspension and adherent cultures. Glia 2007 Mar; 55(4): 385-399.
S3. Zhang J, Tam WL, Tong GQ, Wu Q, Chan HY, Soh BS et al. Sall4 modulates embryonic stem cell pluripotency and early embryonic development by the transcriptional regulation of Pou5f1. Nat Cell Biol 2006 Oct; 8(10): 1114-1123.
S4. White SM, Renda M, Nam NY, Klimatcheva E, Zhu Y, Fisk J et al. Lentivirus vectors using human and simian immunodeficiency virus elements. J Virol 1999 Apr; 73(4): 2832-2840.
S5. Sastry L, Johnson T, Hobson MJ, Smucker B, Cornetta K. Titering lentiviral vectors: comparison of DNA, RNA and marker expression methods. Gene Ther 2002 Sep; 9(17): 1155-1162.
Supplementary Table 1
b-actin Forward / CAATGTGGCCGAGGACTTTG
b-actin Reverse / CATTCTCCTTAGAGAGAAGTGG
DISC1 Forward / ATCGTAGGTAGTCATGCAATCCG
DISC1 Reverse / GTAGTGCATCGATTCGATGCGATG
GAPDH Forward / CGATGCTGGCGCTGAGTACG
GAPDH Reverse / AGAGGGGGCAGAGATGATGACC
Supplementary Figure Legend
Figure 1 (a, b) A representative confocal photomicrograph and flow cytometry of neural progenitor cells (NPCs) derived from (a) subventricular zone (SVZ) and (b) RenCell CX, displaying a high level of proliferation marker Ki67 and NPC markers nestin, sox2 and vimentin. Scale = 30 mm. (c) A representative confocal photomicrograph of 6 week-differentiated SVZ-NPCs. Note GABA (red) positive cells also express calcium binding protein calbindin-d28k (green), reminiscent of interneurons. Scale = 50 mm. (d) A representative confocal photomicrograph of 4 week-differentiated RenCell CX. In accordance with cortical origin, differentiated RenCell CX gives rise to glutamatergic-like cells expressing vesicular glutamate transporter (VGLT) 1 (red) and Tuj1 (green). Scale = 10 mm. (e) Quantitative real-time (q-RT) PCR analysis of DISC1 mRNA level after plentilox 3.7 mediated RNA interference. A significant reduction (70-80%) of DISC1 mRNA expression was observed in SVZ-NPCs and RenCell CX transduced with shRNA1 or shRNA2 compared with shRNA control (**; p<0.01). (f) q-RT PCR analysis of DISC1 mRNA level in transduced RenCell CX at day 3, 7 and passage 3. Constitutive DISC1 knockdown persisted for at least 3 weeks after a single inoculation of DISC1 targeting lentiviral vector. (g) A schematic describing Oris migration assay.
9