Supplementary Information for "Lrs14 transcriptional regulators influence biofilm formation and cell motility of Crenarchaea"
by Orell et al.
Protein sequence analysis
Similarity searches were conducted using BLASTP at the National Center for BiotechnologyInformation (NCBI). Multiple alignment of archaeal Lrs14-like and Lrp/AsnC protein sequences was constructedusing the CLUSTALW program (Thompson et al. 1994), followed bymanual adjustment.Domain analysis on protein sequences was performed using SMART 4.0 (Letunic et al. 2004). Jpred3 was used for secondary structure prediction (Cole et al. 2008).Phylogenetic analyses were conducted using MEGA4 (Tamura et al. 2007). The evolutionary history was inferred using the Neighbor-Joining method (Saitou & Nei 1987). The bootstrap consensus tree inferred from 1000 replicates was taken to represent the evolutionary history of the analyzed taxa. Branches corresponding to partitions reproduced in less than 50% bootstrap replicates were collapsed. The evolutionary distances were computed using the Poisson correction method (Zuckerkandl & Pauling 1965). All positions containing gaps and missing data were eliminated from the dataset (complete deletion option).
Construction of plasmids for in-frame gene deletion and in-trans-complementation
For the construction of the deletion mutant plasmids, the respective up- and down-stream flanking regions of saci0102, saci0446, and saci1242, respectively, were PCR amplified from S.acidocaldarius genomic DNA using primer pairs as listed in Table S1. The up- and down-stream flanking DNA regions were joined by means of overlap extension PCR using the outward bound primer of the respective primer pair. The overlap extension PCR products were restricted with PstIand BamHI and subsequently ligated intothe plasmid pSVA406, containing the pyrEF cassette from S. solfataricus(Wagner et al. 2009). This ligation yielded deletion plasmids pSVA452, pSVA453 and pSVA2004 (see Table 1 for details).
For overexpression of Saci0446 in S. acidocaldariusMW001, the saci0446gene was cloned into the S. acidocaldarius expression vector pSVA1450, (Wagner and Albers, unpublished) which is based on pCmalLacS (Berkner et al. 2010) and allows for maltose inducible expression of proteins. saci0446 was first cloned into pMZ1 yielding pSVA2022, thereby adding 6 histidine residues to the N-terminus of saci0446, which originate from the multiple cloning site of pMZ1. pMZ1 contains an expression cassette for Sulfolobus species including a terminator region(Zolghadr et al. 2007). The saci0446gene was then excised with the terminator region from pSVA2022 using NcoI/ EagI and ligated with pSVA1450. This construct was termed pSVA2026.
A plasmid for the complementation of Saci0446 including its promoter DNA region was constructed in the expression plasmid pSVA1450. The saci0446 gene including its promoter region was,therefore, amplified using primer pair 4069/4070. The PCR product was restricted with SacII/EagIand ligated intopSVA1450 yielding plasmid pSVA2024.
Plasmids pSVA2024 and pSVA2026 were methylated using the E. colistrain ER1821 as described by Wagner et al. (2012). Methylated plasmids were transformed into S.acidocaldarius cells as described previously (Wagner et al. 2012). Plasmid containing colonies were selected on gellan gum solidified Brock medium plates without uracil. Obtained colonies were grown in liquid Brock medium and used for the inoculation of biofilms. All constructs were sequenced to confirm their identity. The primer sequences are given in Table S1.
Construction of chromosomal deletion mutants
In frame marker-less deletion mutants were generated for genes saci0102, saci0446, and saci1242. To this end, methylated deletion mutant plasmids pSVA452, pSVA453 and pSVA2004 were electroporated into MW001 as described by Wagner et al. (2012). Integrants were selected on uracil selective gelrite plates after 5 days of incubation at 75°C and subsequently subjected to 5-FOA (100 µg/ml) gelrite plates to allow the excision of the DNA region containing the target gene. In frame marker-lessdeletion mutants were confirmed by sequencing of PCR products that were obtained using primers binding at least 100 bp up and downstream of the respective primers used for the construction of the flanking regions for the deletion mutant plasmids.
Gene disruptions by S. solfataricuspyrEF cassette exchange via homologous recombination were generated for saci0133, saci1219 and saci1223. To this end, 50 bp of the up and downstream regions of eachtarget gene were added to the 5’ and 3’ ends of the pyrEFcassette via PCR. S. acidocaldarius MW001 cells were electroporated with ~300 ng of the corresponding PCR product. Transformed cells were selected on uracil selective gelrite plates after 5 days of incubation at 75°C. Obtained colonies were transferred to liquid Brock medium. Deletion mutants were confirmed by sequencing of PCR products that were obtained using primers that bound at least 100 bp up and downstream of the target gene and one reverse and one forward primer annealing in the pyrEF cassette sequence, respectively.
Western blotting
Cultures for immunological analyses were grown in liquid Brock medium to reach an OD600 0.5 and harvested by centrifugation at3400 x g. The pellet was resuspended in fresh medium without nutrient source. After 4 h, 0.001% tryptone was added to eachculture and further incubated at 76 °C overnight. Cells were harvested and thepellet was resuspended in buffer containing 50 mM HEPESand 150 mM NaCl. Proteins were separated by SDS-PAGEaccording to the method of Laemmli (Laemmli, 1970) andtransferred to a PVDF membrane (Roche) by semi-dry blotting. Polyclonal peptide antibodies against S. acidocaldarius anti-FlaB were raised in rabbits (Eurogentec). Binding of the secondary antibody, thealkaline phosphatase goat anti-rabbit immunoglobulin G(Sigma) was detected by usingthe CDP-star chemiluminescent detection kit (Roche) according to the manufacturer’s instructions. Chemiluminescencewas measured using the LAS-4000 Luminescent image analyzer(Fujifilm, Düsseldorf, Germany).
Heterologous expression of saci0446 andprotein purification
To expressN-terminal histidine tagged Saci0446 protein, saci0446 was amplifiedby PCR from genomic DNA of S. acidocaldarius DSM639 using primer (Table S1) and cloned into the pETDuet-1 vector system (Novagen), yielding plasmid pSVA2009. The constructed plasmid was verified by sequencing of both strands.Heterologous expression of recombinant Saci0446 was performed as reported previously (Ghosh et al. 2011), using E. coliBL21 (DE3)-RIL as expression host strain. For purification of the recombinant protein, the resulting E. coli crude extracts were diluted 1:1 with 50 mM HEPES, 300 mM KCl (pH 7.5) and subjected to a heat precipitation for 10 min at 70°C. After heat precipitation, the samples were cleared by centrifugation (60,000 x g for 30 min at 4°C). The supernatantwas applied to a Ni2+-affinity column (Native IMAC) on theProfiniaTMprotein purification system (Bio-Rad Laboratories).Bound protein was eluted withelution buffer (50 mM HEPES, pH 8.0; 300 mM KCl; 250 mM imidazole). A final desalting step was incorporated during the Profinia purification protocol to wash the imidazole out of the protein sample. Fractions containing the recombinant protein (analyzed by SDS-PAGE and anti-his Western blotting) were pooled and concentrated via centrifugal concentrators (AmiconUltra Centrifugal Filter 5000 MWCO, Millipore) using buffer A (50 mM NaH2PO4, pH 7.5; 100 mM NaCl). Protein samples were used for DNA-protein binding assays or stored at -20°C in presence of 10%glycerol.
DNA-protein binding assays and in gel footprinting experiments
For protein-DNA interaction studies, 5’-end 32P-labeled DNA fragments were generated by PCR-amplifying desired fragments with S. acidocaldarius genomic DNA as template and with two primers, one being labeled with [γ-32P]-ATP with T4 polynucleotide kinase. Following primer pairs were used: ep092/ep093 (promoter/operator (p/o) saci0446), ep094/ep095 (ORF saci0446), ep096/ep097 (p/o saci1178), ep098/ep099 (p/o saci1177), ep100/ep101 (p/o saci2314) and ep102/ep103 (p/o saci1908) (Table S1). Labeled probes were purified on a 6% acrylamide gel. Electrophoretic mobility shift assays (EMSAs) were conducted as described before (Peeters et al, 2007). Binding reaction mixtures were incubated at 37°C for 25 minutes in LrpB buffer and contained, besides different amounts of the protein, 7500 cpm of DNA and 25 mg ml-1 sonicated salmon sperm DNA as non-specific competitor. Gel electrophoresis was performed with 6% native acrylamide gels. EMSA autoradiographs were scanned and integrated densities of individual bands were measured with ImageJ (Abramoff et al., 2004). After subtraction of background densities, values were converted to the fraction of bound DNA. Subsequently, using the Prism 6 software (GraphPad) these data were plotted and fitted to a non-linear model with the Hill function, yielding for each fragment the apparent equilibrium dissociation constant (KD) and the Hill coefficient (n), which represents a measure of the binding cooperativity.
For in gel footprinting with the 1,10-phenantroline-copper ((OP)2-Cu+) ion (Cu-OP) of the different DNA populations, an EMSA was performed with approximately 100,000 cpm DNA in each binding reaction before performing chemical footprinting, exposure to a X-ray sensitive film, excision and elution of different populations and analysis on a 8% denaturing acrylamide gel. The procedure was followed as described before (Peeters et al, 2004). Reference ladders were generated by chemical sequencing (Maxam & Gilbert, 1980).
References
Berkner S, Wlodkowski A, Albers S V, Lipps G. (2010).Inducible and constitutive promoters for geneticsystems in Sulfolobus acidocaldarius. Extremophiles14: 249–259.
Cole C, Barber JD, Barton GJ. (2008). The Jpred 3 secondarystructure prediction server. Nucleic Acids Res36:W197–W201.
Dubois M, Gilles KA, Hamilton JK, Rebers PA, Smith F.(1956). Colorimetric method for determination ofsugars and related substances. Anal Chem28:350–356.
Ghosh A, Hartung S, Van Der Does C, Tainer JA, Albers SV.(2011). Archaeal flagellar ATPase motor shows ATP-dependent hexameric assembly and activity stimula-tion by specific lipid binding. Biochem J437: 43–52.
Letunic I, Copley RR, Schmidt S, Ciccarelli FD, Doerks T,Schultz Jet al.(2004). SMART 4.0: towards genomic data integration. Nucleic Acids Res32: D142–D144.
Petersen GL. (1977). A simplification of the protein assayof Lowry which is more generally applicable. Anal Chem 83: 346–353.
Saitou N, Nei M. (1987). The neighbour-joining method: anew method for reconstructing phylogenetic trees.Mol Biol Evol4: 406–425.
Tamura K, Dudley J, Nei M, Kumar S. (2007). MEGA4:Molecular Evolutionary Genetics Analysis (MEGA)software version 4.0. Mol Biol Evol24: 1596–1599.
Thompson JD, Higgins DG, Gibson TJ. (1994). CLUSTALW: improving the sensitivity of of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice. Nucleic Acids Res22: 4673–4680.
Wagner M, Berkner S, Ajon M, Driessen AJ, Lipps G,Albers SV. (2009). Expanding and understanding thegenetic toolbox of the hyperthermophilic genus Sulfolobus. Biochem Soc Trans 37: 97–101.
Zuckerkandl E, Pauling L. (1965). In Bryson V, Vogel HJ(eds). Evolutionary divergence and convergence. In Evolving Genes and Proteins97: pp 97–166.
Figure S1. Sequence analysis of archaeal Lrs14-like proteins. (A) Multiple alignments of archaeal Lrs14 proteins together with E. coli Lrp and S. solfataricus Ss-LrpB protein sequences. Residues conserved ≥ 90 % areshown by (:)and (.) represents residues sharing 50% of conservation.Secondary structure prediction for both Lrs14-like proteins and Lrp-like proteins are indicted above the alignment (α helixes: yellow cylinders, β sheets: green arrows).The six S. acidocaldarius homologous Lrs14-like proteins are shown in bold. The location of a putative HTH motif and the RAM domain areindicated above the alignment. Accession numbers and ORF numbers are indicated. Species abbreviations: S.so,Sulfolobus solfataricus; S.ac, Sulfolobus acidocaldarius; S.to, Sulfolobus tokodaii; Hsp, Halobacterium sp. NRC1; E.co, Escherichia coli. (B) The NJ distance tree was constructed using a subset of each archaeal Lrs14-like and Lrp-like proteins. The six S. acidocaldarius homologous Lrs14-like proteins are underlined and the corresponding ORF numbers are depicted. Accession numbers are indicated in parentheses. Bootstrap values, based on 1000 repetitions, are shown next to the branches. Bar, 10 % estimated divergence.
Figure S2.Expression profile of S. acidocaldariusMW001 lrs14 genes of biofilm-associated cell population versus planktonic cell population. After 3 day biofilm growth the supernatant of the Petri dishes containing the planktonic cells was carefully removed. The biofilmwas washed with 50 mLof Brock media and consecutively harvested with a cell scraper. Total RNA was isolated from both cell samples. qRT-PCR analysis were performed using specific primers for each Lrs14 encoding ORF (shown underneath the plot). Relative transcript expression levels of each gene were normalized to the internal control gene secY. The values reflect the fold change in gene expression compared with cDNA prepared from biofilm-associated cell population versus planktonic cell population. The means and standard deviations of 3 biological replicates are shown.
Figure S3. Construction of Lrs14 deletion mutants.(A) PCRs were performed withreference strain MW001 and the respective in-frame lrs14deletion mutant genomic DNArevealing a downshift of the correspondingDNA band of the mutant DNA. (B) PCR of the deletion mutant generated by insertion of the pyrEF selection cassette. One forward primer annealing up-stream of the target gene and one primer annealing within the pyrEF cassette sequence were used. This primer combination allows amplifications only when mutant DNA is used as a template.
Figure S4. Planktonic growth of S. acidocaldarius Lrs14 deletion mutant strains.Shakingcultured mutant strains were sampled at various time points to measure cell density atOD600. Reference strain MW001 (-◊-) and marker-less deletion mutants Δsaci1242 (-Δ-), Δsaci0446(-○-), Δsaci0102 (-□-). Wild type of pyrEF disrupted deletion mutants MW001+pyrEF(-♦-) and disrupted deletion mutants Δsaci0133 (-■-), Δsaci1219 (-▲-), Δsaci1223 (-●-). Each pointrepresents the mean of 3 biological replicas.
Figure S5.CLSM analysis of biofilm formed by S. acidocaldarius MW001pyrEF+ strain. Three days old biofilms were subjeted toCLSM. The blue channel is the DAPI-staining. The green channel represents the fluorescently labeld lectin ConA that binds to glucose and mannose residues. The lectin IB4 able to bind to α-galactosyl-residues is shown in yellow. The overlay image of all three channels is shown (left panel).DIC pictures (midle panel) were taken from the bottom layer of biofilms and converted into black/white (right panel) to calculate the surface coverage. Numbers represent the percentage of surface coverage. Scale bar = 20 µm.
Figure S6.His-tagged Saci0446 protein purification. The elution fraction obtained from a Ni2+-column chromatography was analyzed on a SDS-PAGE and stained with Coomassie. Bars to the left side indicate molecular weights in kilo Daltons. Expected size of His-tagged saci0446 protein is 14.97 kDa.
Figure S7. Footprinting assays of Saci0446 binding to its own promoter.(A)In-gel’ Cu-OP footprinting analysis of binding of saci0446 to a promoter fragment of its own gene with the top strand labeled. In the upper part, the preceding EMSA is shown with indicating of the different free (F) and bound (B) populations as they were excised for further analysis. Protein concentrations are indicated in µM. In the lower part, the footprint autoradiograph is shown with indication of the C+T sequencing ladder, aligned to the footprint lanes, and the different populations. Protected and hyperreactive regions in the higher-order complex are indicated to the right of the autoradiograph with open and grey rectangles, respectively.(B)In gel Cu-OP footprinting analysis of binding of saci0446 to a promoter fragment of its own gene with the bottom strand labeled. Notations are the same as in panel B, except that an A+G ladder has been included and that ball-and-stick symbols indicate hyperreactivity positions observed in lower-order complexes.(C) saci0446 promoter sequence with summary of footprint results. The translational stop and start codon of saci0445 (CAA on top strand) and of saci0446 (ATG on top strand) have been highlighted in bold. The notation of protected and hyperreactive regions is the same as in panels B and C.
Explanation belonging to the footprinting assays:
To identify potential recognition motifs, we performed in gel Cu-OP footprinting with the p/o saci0446 probe, which is bound by Saci0446 with one of the highest affinities (Fig. 7B). For the nucleoprotein complexes with the highest electrophoretic mobility and lowest binding stoichiometries, no obvious protection zones were observed. This result suggested that complex populations consists of complexes bound at different locations and that Saci0446 binds with a low sequence specificity, a conclusion that is corroborated by the fact that the number of electrophoretically distinct complexes is proportional to DNA fragment length (data not shown). The protected regions observed in the complexes with higher stoichiometry are not well delineated and did not lead to the identification of a recognition binding motif (Fig. 6B). Interestingly, a negative correlation exists between the AT level of the tested DNA sequence and the apparent KD (Pearson’s correlation coefficient r −0.8522 and R2 0.73), demonstrating that Saci0446 interacts with AT-rich sequences with a higher affinity.
In the footprint experiment with the bottom strand labeled, two positions exhibited hyperreactivity in the lower-order complexes, demonstrating protein-induced deformations at these specific locations (Fig. 7B/D). In the higher-order complexes extensive hyperreactivity occurs, leading to higher cleavage efficiencies of longer DNA molecules. Based on these cleavage patterns, it is likely that considerable conformational changes occurred in the DNA upon cooperative binding of multiple Saci0446 molecules. A similar footprinting pattern was observed for p/o Saci1908 (data not shown).
Table S1. Oligonucleotides used in this study
Primer no. / sequence / description1004 / 5‘-GGGCCATGGAACTCAGGGTGAAAACCTAC / Forward primer for upstream region Δsaci0102 with ApaI restriction site
1005 / 5‘-CAAGGGAATTACTGGGACATTTATCTCACAAATAAAGTTC / Reverse primer for upstream region Δsaci0102, overlapping region
1006 / 5‘-GTGAGATAAATGTCCCAGTAATTCCCTTGACTTTTCCCC / Forward primer for downstream region Δsaci0102, overlapping region
1007 / 5‘-GCGGGATCCGGTTTGCGTGCTATATTCAG / Reverse primer for downstream region Δsaci0102 with BamHI
2413 / 5‘-TTGGGCTACAGAGGGACTTC / Forward sequencing primer Δsaci0102
2414 / 5‘-TTTGTCCACGAGGACTAACG / Reverse sequencing primer Δsaci0102
1012 / 5‘-GGGCCATGGTTCCGTCGGAAGTGTCAAC / Forward primer for upstream region Δsaci0446 with ApaI restriction site
1018 / 5’-GCATAATTCCTCTTCAATACTCATTTTAATCTCGCCTTTG / Reverse primer for upstream region Δsaci0446 , overlapping region
1019 / 5’-GAGTATTGAAGAGGAATTATGCAAAGAATTAAACCAAG / Forward primer for downstream region Δsaci0446 , overlapping region
1073 / 5’-GATGGATCCGTAGGCTCAGTGGCTTTAAC / Reverse primer for downstream region Δsaci0446with BamHI
2415 / 5‘-GACGATACGCCTGTAGTTTG / Forward sequencing primer Δsaci0446
2416 / 5‘-ACTGAAGGGCGGTTTCTATC / Reverse sequencing primer Δsaci0446
2417 / 5‘-GTAGGGCCCCAGGCATGAGACCCAATACG / Forward primer for upstream region Δsaci1242 with ApaI restriction site
2418 / 5‘-GAACCAATGAGTTAATATATTCAATTTTTAAC / Reverse primer for upstream region Δsaci1242, overlapping region
2419 / 5‘-ATTGAATATATTAACTCATTGGTTCTTGGCTG / Forward primer for downstream region Δsaci1242, overlapping region
2420 / 5‘-GATGGATCCCCTCTAGCAGGAAGTCTTTG / Reverse primer for downstream region Δsaci1242 with BamHI
2421 / 5‘-AGGGTATCTCGTTTCACCAG / Forward sequencing primer Δsaci1242
2422 / 5‘-TGCAGTTAAGGCAACTGTGG / Reverse sequencing primer Δsaci1242
2497 / 5‘-CACTTTTTTTAGTTAGCAAAAACAAGTAATATTCGGAGTGATACAAAATGTTTGAGCAGTTCTAG / Δsaci1223 Forward for pyrEF exchange
2498 / 5‘-CTATAGTAATAAGAGGAGATAATGTTATCTTAGTGTCTCCTGTTTAAGACGACCGGCTATTTTTTCAC / Δsaci1223 Reverse for pyrEF exchange
4043 / 5‘-TTTACTTTTTAATGAAAAGATTTAAATATGAGTATTTAAAATGAATTAATTTTGAGCAGTTCTAG / Δsaci0133 Forward for pyrEF exchange
4044 / 5‘-ATTTGATGAAATAAATCCTAAACCTGTAATTAATATTTTCACAGGCTAAAGACCGGCTATTTTTTCAC / Δsaci0133 Reverse for pyrEF exchange
4055 / 5‘-CAGAAGAAGGAGGAAAAGCAAGAAGAAAGTAAAAGTTAGATACTTTAGTTTTTGAGCAGTTCTAG / Δsaci1219 Forward for pyrEF exchange
4056 / 5‘-ATAAAAATCGAAGGTAAAGTTTTTTAATTTTTAATAACTTTATATTGCTTGACCGGCTATTTTTTCAC / Δsaci1219 Reverse for pyrEF exchange
2488 / 5‘-AGTAGCCTATGGTCTTTCTGAATC / saci0446 forward qPCR primer
2489 / 5‘-TCAACTAATCCTGCATCTGAAAGC / saci0446 reverse qPCR primer
2490 / 5‘-AGCGGTGCTAAAGGCACAGAAG / saci0102 forward qPCR primer
2491 / 5‘-GGTCTACCCGCCTTATTTACAG / saci0102 reverse qPCR primer
2492 / 5‘-GAGGCGTTGAAGTTCTGCTATGAC / saci0133 forward qPCR primer
2493 / 5‘-CGCTCCTGTTTATGGAGGCTTTAG / saci0133 reverse qPCR primer
1112 / 5‘-GGGCCATGGTTCCGTCGGAAGTGTCAAC / Saci1223 forward qPCR primer
1113 / 5‘-GGAGACAGTACTTCAAATTCCATATC / Saci1223 reverse qPCR primer
1114 / 5‘-GATTAAAATGAGTATAAACCAAG / Saci1242 forward qPCR primer
1115 / 5‘-GCCATATCCTCACTTATGACTTGG / Saci1242 reverse qPCR primer
1116 / 5‘-CTGAGAGGCTAACGTCTCTAAATC / Saci1219 forward qPCR primer
1117 / 5‘-GAAGCAGGAGAAGAGAAGAAGAAG / Saci1219 reverse qPCR primer
1424 / 5‘-ACTGCGTCTACTGCGTTATCTTTATC / flaB forward qPCR primer
1425 / 5’-GGAGATAAGTCTACACTAGATACACCAGAA / flaB reverse qPCR primer
1426 / 5‘-GCAGTTGAAGAGTTAGCCTTATCTGTG / flaX forward qPCR primer
1427 / 5‘-CCTACTAACTGACTTACGGTACTAATCT / flaX reverse qPCR primer
696 / 5’-CTCTAATTTTAACGTCTCAGTAACTAGC / aapA forward qPCR primer
697 / 5’-CCTACTTGTTCCATAGGATTGTTAGG / aapA reverse qPCR primer
3512 / 5’-CTCCTGACTACCAACTGACTATTTATC / aapFforward qPCR primer
3513 / 5’-GTTCACCAGTAGAATAGCTCTTTACAC / aapF reverse qPCR primer
2079 / 5’-TAGCCAGGGTATGTTCAGTAATC / upsA forward qPCR primer
2080 / 5’-ACCTAAGTTCCCGTTATTGAC / upsAreverse qPCR primer
2075 / 5’-GCTAGTAAAGCCAACAAGAGTG / upsE forward qPCR primer
2075 / 5’-ATATAGTCGCTGCTACCCTATG / upsE reverse qPCR primer
1480 / 5’-CCTGCAACATCTATCCATAACATACCGA / secY forward qPCR primer
1481 / 5’-CCTCATAGTGTATATGCTTTAGTAGTAG’ / secY reverse qPCR primer
4077 / 5’-CGTCTATCGCTTTCGTGATCTG / saci1904 forward qPCR primer
4078 / 5’-TCTTACCCTACGTACACGAGAG / saci1904 reverse qPCR primer
4079 / 5’-GCTCCCGAAGTCCATATAAGG / saci1905 forward qPCR primer
4080 / 5’-GTTCTAGGTGGACTCGGTAAG / saci1905 reverse qPCR primer
4319 / 5’-AGTCGGACCATAGACACTAGAG / saci1906 forward qPCR primer
4320 / 5’-GACACGCCAGGAGCTTTATATC / saci1906 reverse qPCR primer
4081 / 5’-ATCCTTATGCTGGTGGCTCTG / saci1907 forward qPCR primer
4082 / 5’-TCTCGTTCCTCCCTTCCAATC / saci1907 reverse qPCR primer
4083 / 5’-CACCAGCCCTCTTCTCTAC / saci1908 forward qPCR primer
4084 / 5’-GTCCTGCACTGACCAATACC / saci1908 reverse qPCR primer
4085 / 5’-GTGTTGTGATACCGGCATAC / saci1909 forward qPCR primer
4086 / 5’-GGCGGAGTCGAACCATATAC / saci1909 reverse qPCR primer
4321 / 5’-TGCCTTCCCGTTATCATCAGTC / saci1910 forward qPCR primer
4322 / 5’-TACAGTCGCTCTGAACGGATAC / saci1910 reverse qPCR primer
4323 / 5’-GGTCGATTGAGATCCCAGTTGTTC / saci1911 forward qPCR primer
4324 / 5’-CTTTCTCCCTGACCTCCTTAAACC / saci1911 reverse qPCR primer
4087 / 5’-ATGTACCCGGACCTGGATATG / saci1912 forward qPCR primer
4088 / 5’-TCGGATGCTGGCAAATCAC / saci1912 reverse qPCR primer
2453 / 5‘-CCCCCGAATTCGATGAGTATTGAAATTACTG / Forward primer for cloning saci0446 into pETduET with EcoRI restriction site
2454 / 5‘-CCCCGCGGCCGCTTAAATAAAAGACTTAATAAC / Reverse primer for cloning saci0446 into pETduET with NotI restriction site
4067 / 5‘-GTACCATGGGTATTGAAATTACTGAAAAATATG / Forward primer for cloning saci0446 into pMZ1 with NcoIrestriction site
4068 / 5‘-GATGGATCCAATAAAAGACTTAATAACTTGG / Reverse primer for cloning saci0446 into pMZ1 with BamHIrestriction site
4069 / 5‘-GATCCGCGGATACCCTGTCTGTTCTCTTC / Forward primer for cloning saci0446 into pSVA1450 with SacIIrestriction site
4070 / 5‘-GTACGGCCGTTAAATAAAAGACTTAATAACTTGG / Reverse primer for cloning saci0446 into pSVA1450 with EagIrestriction site
ep092 / 5’-ataccctgtctgttctcttc / Forward EMSA probe (p/o) saci0446
ep093 / 5'-CAATACTCATTTTAATCTCGCC / Reverse EMSA probe (p/o) saci0446
ep094 / 5'-CAGTAGCCTATGGTCTTTCTGAATC / Forward EMSA probe (ORF) saci0446
ep095 / 5’-CCTTCATGTTATCTCCTTTTTCCT / Reverse EMSA probe (ORF) saci0446
ep096 / 5’-attgccttctcatcagtatcatg / Forward EMSA probe (p/o) saci1178
ep097 / 5’-CCTTCTTTTCATGTATATCATGTT / Reverse EMSA probe (p/o) saci1178
ep098 / 5’-cagtatatctatcagcctgatgg / Forward EMSA probe (p/o) saci1177
ep099 / 5’-CTATAGGTATACCAACTCCTATC / Reverse EMSA probe (p/o) saci1177
ep100 / 5’-ctaattacttgtatacatttgtaag / Forward EMSA probe (p/o) saci2314
ep101 / 5’-TAACGTGATATCATGGTAATCTTA / Reverse EMSA probe (p/o) saci2314
ep102 / 5’-ccgaaaacgattaatggtaagga / Forward EMSA probe (p/o) saci1908
ep103 / 5’-GTGCACTCCTTAAAGAAAACACA / Reverse EMSA probe (p/o) saci1908
1