Supplemental Methods

Cell lines, Tissue Culture and Transfections.

HEK293 FlpIn cells were maintained in a 10% CO2 humidified incubator, in DMEM high glucose media supplemented with 8% FCS containing 50 ug/ml Zeocin and 5 ug/ml blasticidin(Invitrogen, Carlsbad, CA). The high CO2 is required by DMEM media to maintain proper pH. Derivative 293FI lines containing the shuttle vector pcDNA5/FRT/TO and inserted genes were selected in 50 ug/ml hygromycin B. Renal cancer cell lines SKRC-02, -09 and -17 were kindly provided by Dr. Elisabeth Stockert (Tumor Cell Bank, Memorial Sloan-Kettering Cancer Center, NY, NY) and maintained in RPMI-1640 and 5% CO2 with 10% FCS. DNA transfections were performed with FuGENE6 according to manufacturer’s directions (Roche Diagnostics, Indianapolis, IN). Luciferase assays were conducted according to the luciferase assay kit directions (Promega, Madison, WI).

Antibodies and Western blots.

Antibodies were obtained from the following sources; anti-Chk2 and ATM antibodies (Cell Signaling Tech. (Danvers, MA), anti-HA (Y-11, Santa Cruz Biotechnology, Santa Cruz, CA), anti-tubulin [Ab-2, DM1A, Labvision/NeoMarkers, Fremont, CA), anti-actin (AC-74, Sigma-Aldrich, St. Louis, MO) and anti-TRC8/RNF139 (Abnova Corp., Taipai, Taiwan). Anti-gp78 antibody was described previously (Fang et al., 2001). Western blots were carried out by electrophoretic transfer of proteins from SDS-PAGE gels to PVDF membrane (Millipore Corp). Membranes were blocked for 1 h in phosphate buffered saline (PBS) containing 0.1% Tween-20 and 10% non-fat dry milk (NFDM). Primary antibodies were diluted in PBS/Tween/1% NFDM according to manufacturers suggestions and incubated with blocked membranes for 1 h at 25oC. Following extensive washings with PBS/T (5 changes over 30 min), membranes were incubated with 1:10,000 dilution of HRP-conjugated goat anti-rabbit or goat anti-mouse secondary antibodies (PerkinElmer, Inc., Boston, MA) for 1 h. Membranes were re-washed as before, and signals were developed using SuperSignal West Dura extended duration ECL substrate (Pierce, Rockford, IL) following manufacturer’s directions.

In vitro ubiquitylation reactions. A GST-ubiquitin fusion protein including a PKA phosphorylation site and a thrombin cleavage site (Lorick et al., 1999) was expressed from pGex-2TK in E. coli and purified by glutathione sepharose chromatography. GST-Ub-bound beads were resuspended in 1x PKA buffer, with -32P-ATP and bovine heart PKA catalytic subunit. Following incubation at 37C for 1 h, beads were washed, cleaved with thrombin and labelled ubiquitin recovered. In vitro ubiquitylations were performed using purified GST-TRC8 fusions incorporating C-terminal amino acids 513-664. GST-AO7(Lorick et al., 1999) provided a positive control. Twenty pmol of GST or GST-fusion protein were bound to 50 L of glutathione sepharose beads (30 m @ 4oC), washed with 50 mM Tris/0.1 % Triton-X 100 and a 30 L ubiquitylation reaction mixture was added containing 100 ng mouse E1, 100 ng Ube2d2, 10,000 CPM of 32P-Ub, and ubiquitylation buffer [50 mM TrisHCl, pH 7.4, 0.2 mM ATP, 0.5 mM MgCl2, 0.1 mM DTT, 1 mM creatine phosphate (135 ng) and 1500 U phosphocreatine kinase (porcine heart)]. Beads were washed extensively following incubation for 1.5 h at 30oC, then analyzed by SDS-PAGE and phosphorimaging.

Quantitative RT-PCR

Real time quantitative RT-PCR was carried out as described previously. Primer sequences used were (5’ to 3’): TRC8: forTGGCAAATGAAACTGATTCC, rev ACAGTTAGTGTAGAATCGCACCC; HMGCR: for CAG GGA ACC TCG GCC TAA TG, rev CGG CGA ATA GAT ACA CCA CGC; FAS: for CACAGTCACCATCTCGGGACC, rev CTCCCGGATCACCTTCTT GAG.