Phillips ISME 2012 Supplementary Information

Phillips ISME 2012 Supplementary information

Figure S1. Construction and placement of hyphal-trap mesh bags with saprotroph-excluding sand barriers. (A) Placement of container within fermentation-humic layer at the Crow Creek research site. (B) Container at sampling, illustrating holes punched to allow hyphal access (C,D) Inner (+SB) mesh bag placement within the sand-filled container. (E) Hyphal colonization of +SB mesh substrate.

Detailed enzyme assay methodology

All +SB, -SB, FH, sand, and residual-activity control samples, as well as EM tips selected from the FH samples, were assessed for the activity of enzymes involved in soil organic matter breakdown (Table 1), using previously described methods (tips: Courty et al., 2005 and Pritsch et al., 2004; +SB, -SB, FH, sand, controls: Saiya-Cork et al., 2002 and Sinsabaugh et al., 2003). Unless otherwise stated, all reagents were from Sigma-Aldrich, St. Louis, USA.

Mesh bag and FH substrates: For +SB, -SB, FH, and residual activity control assays, 5.0 g of sample was homogenized with a sterile mortar and pestle, a 0.1 g sub-sample was transferred to a sterile Nalgene bottle containing 100 ml 50 mM sodium acetate buffer (pH 5.0), and suspensions were shaken for 1 hr at 500 rpm. Sand samples were similarly processed using 10.0 g of sample and 1.0 g of sub-sample.

For fluorometric assays, 200 µL of each sample suspension were aliquoted into 96-well microplates (eight replicate wells per sample) and 50 µL of 200 µM enzyme substrate (Table 1) was added. Colourimetric laccase assays used 4 mM 2,2’-Azino-bis(3-ethylbenzothiazoline-6 sulfonic acid) diammonium salt (ABTS); colourimetric peroxidase assays and phenol oxidase used 25 mM L-3, 4-dihydroxyphenylalanine (DOPA), with or without the addition of H2O2, respectively. Separate sample suspension background plates were set up for all assays and quench plates were set up for fluorometric assay. Background wells contained 200 µL of sample suspension and 50 µL buffer (eight replicate wells per sample); quench wells contained 200 µL of sample suspension and 50 µL 10 µM 4-methylumbelliferone (MU) or 7-amino-4-methyl coumarin (AMC) standard solutions (eight replicate wells per sample). Enzyme substrate background controls (50 µL of the relevant enzyme substrate in 200 µL acetate buffer) were included on all plates (eight replicate wells each) and reference standards (50 µL 10 µM MU or AMC in 200 µL acetate buffer) were included on fluorometric plates. The microplates were incubated in the dark for 2 to 18 hours, depending on the assessed enzyme (Table 1). Fluorescence reactions were stopped by adding 20 µl 0.5M NaOH to each well. Fluorescence (excitation 360 nm, emission 460 nm) or absorbance (laccase, 420 nm; peroxidase, phenol oxidase 460 nm) was immediately measured post-incubation (BMG FLUOstar Galaxy microplate reader, BMG Labtech, Germany).

Fluorescence activity rates were expressed as nmol h-1 g-1 after correction for quenching and background (sample solution and enzyme substrate) fluorescence. After background corrections, ABTS-laccase concentrations were determined using the Beer-Lambert law A=εbc, where A= absorbance, ε = wavelength dependent molar absorptivity for ABTS under the conditions of this assay (3.6 x 104 M-1 cm-1), b = path length (0.32 cm), and c = sample concentration. After background corrections, DOPA concentrations were determined using a standard molar extinction coefficient of 7.9 µmol-1 (Sinsabaugh et al., 2003). Final peroxidase activity was determined by subtracting the phenol oxidase activity from the peroxidase assays.

Tip assays: For EM tip assays, roots from the FH sample were gently washed over a 2 mm sieve, separated under a dissecting microscope, and turgid ectomycorrhizae between 2 to 3 mm in length were randomly selected. Approximately seven active tips from each of the four most common observed morphotypes were chosen from each sample. All tips were cleaned of all debris and placed in individual micro-sieves in 96-well microplates containing 75 mM Tris-maleic acid buffer (pH 4.5) to equilibrate for at least 5 min prior to beginning the sequential enzyme assays (Table 1). For each assay, sieves containing tips were transferred to an incubation plate containing the substrate and incubated in the dark with gentle shaking (100 rpm) at 21°C. Sieves were then placed back in a rinse plate with Tris-maleic buffer of the appropriate pH (Table 1) for 5 min to minimize interference from previous assays. Aliquots from the incubation plate were transferred to a new plate containing stop buffer (75 mM Tris-maleic acid buffer, pH 11.0) and fluorescence or absorbance was measured as outlined above. After the final assay, tips were removed from the sieves, scanned (Scanmaker 8700, Microtek Lab, USA), and their surface areas were determined (WinRHIZO, Regent Instruments, Canada). All tips were then frozen -80 oC for molecular analysis.

The concentration of cleaved fluorometric substrates was calculated based on calibration curves generated with fluorescent MU or AMC and results were expressed as pmol MU or AMC min-1 mm-2 surface area of the tip. Laccase concentrations were calculated as above. The total enzymatic activity of EM tips per plot was determined by averaging the activities of all tips. EM taxon-specific activities were determined by averaging the activity of the (up to) seven EM tips per plot, whose identities were confirmed by morphological and molecular identification

Table S1.Assessed hydrolytic and oxidative enzyme assays, listing enzyme roles and assay parameters for soil and mycorrhizal tips.

Hyphal trap assays / EcM tip assays
Enzyme tested / Substrate / General role / Incubation time (hr) / Incubation buffer pH / Incubation time (min)
Acid phosphatase (EC 3.1.3.2) / MU-phosphate / Phosphate mobilization / 2 / 4.5 / 10
Sulfatase (EC 3.1.6.1) / MU-sulfate / Sulphate-ester hydrolysis / 3 / 6.0 / 20
Leucine aminopeptidase (EC 3.4.11.1) / L-Leucine 1 Amido-4-methylcoumarin / Nitrogen mobilization / 2 / 6.5 / 60
β-1,4-N-Acetylglucosaminidase EC 3.2.1.52) / MU-N-acetyl–β- glucosaminide / Chitin degradation / 3 / 4.5 / 20
β-1,4-Glucosidase (EC 3.2.1.21) / MU-β-D-glucopyranoside / Cellulose degradation / 3 / 4.5 / 20
Cellobiohydrolase (EC 3.2.1.91) / MU-β-D-cellobioside / Cellulose degradation / 7 / 4.5 / 40
β-1,4-Xylosidase EC 3.2.1.37) / MU-β-D-xylopyranoside / Hemicellulose degradation / 4 / 4.5 / 60
Laccase* (EC 1.10.3.2) / ABTS / Lignin degradation / 2 / 4.5 / 60
Peroxidase (EC 1.11.1.7) / L-3, 4-dihydroxyphenylalanine; 0.3% H2O2 / Lignin degradation / 5 / N/A / N/A
Phenol oxidase (EC 1.10.3.2; EC 1.14.18.1) / L-3, 4-dihydroxyphenylalanine / Lignin degradation / 18 / N/A / N/A

MU: methyl-umbelliferyl; ABTS: 2,2’-Azino-bis(3-ethylbenzothiazoline-6 sulfonic acid) diammonium salt; all substrates from Sigma-Aldrich, St. Louis, U.S.A.* Note that although laccases are phenol oxidases, the term laccase is used in the study to differentiate the ABTS assay from the L-DOPA assay.

Table S2: List of Roche-approved Multiplex Identifier tags used to generate pooled amplicon libraries for 454-pyrosequencing. Tags were added to the 3’ end of the Titanium A adaptor (5’CCATCTCATCCCTGCGTGTCTCCGACTCAGA), used along with the Titanium B adaptor (5’CCTATCCCCTGTGTGCCTTGGCAGTCTCAG) to create the final fusion primers:5'-TitaniumA-MID-ITS1f-3' and 5'-TitaniumB-ITS2r-3'.

Tag ID / Sequence / Tag ID / Sequence
MID-1 / ACGAGTGCGT / MID-13 / CATAGTAGTG
MID-2 / ACGCTCGACA / MID-14 / CGAGAGATAC
MID-3 / AGACGCACTC / MID-15 / ATACGACGTA
MID-4 / AGCACTGTAG / MID-16 / TCACGTACTA
MID-5 / ATCAGACACG / MID-17 / CGTCTAGTAC
MID-6 / ATATCGCGAG / MID-18 / TCTACGTAGC
MID-7 / CGTGTCTCTA / MID-19 / TGTACTACTC
MID-8 / CTCGCGTGTC / MID-20 / ACGACTACAG
MID-9 / TAGTATCAGC / MID-21 / CGTAGACTAG
MID-10 / TCTCTATGCG / MID-22 / TACGAGTATG
MID-11 / TGATACGTCT / MID-23 / TACTCTCGTG
MID-12 / TACTGAGCTA

Figure S2 Representative rarefaction curves (98% similarity) for individual sequence datasets from the forest floor (FH), hyphal trap bags with sand barriers (+SB), hyphal trap bags without sand barriers (-SB), and sand barrier samples.

Table S3. Sequence data summary

Sample / Total sequencesa / Quality trimmed sequencesb / Identified sequencesc / Unidentified sequencesd / Total singletonse / Sequence lengthf / OTU clustersg
FH2 / 36184 / 27052 / 25484 / 1568 / 165 / 296 to 66 / 754
FH3 / 36281 / 26201 / 25496 / 705 / 222 / 304 to 65 / 782
FH6 / 16991 / 11773 / 11514 / 259 / 73 / 298 to 85 / 402
FH8 / 33240 / 23566 / 22235 / 1331 / 217 / 336 to 85 / 736
FH11 / 28200 / 17666 / 16929 / 737 / 181 / 328 to 88 / 682
FH14 / 29613 / 18988 / 16760 / 405 / 148 / 330 to 92 / 591
FH15 / 23852 / 15024 / 14528 / 496 / 157 / 291 to 79 / 612
FH16 / 29146 / 17982 / 17584 / 398 / 127 / 280 to 88 / 539
FH17 / 30860 / 19223 / 18763 / 460 / 131 / 281 to 87 / 505
+SB2 / 38644 / 29220 / 26902 / 2306 / 204 / 352 to 72 / 583
+SB3 / 37935 / 27127 / 26051 / 1076 / 157 / 354 to 85 / 519
+SB6 / 33555 / 25168 / 24478 / 690 / 106 / 279 to 88 / 394
+SB8 / 29041 / 21566 / 14196 / 7370 / 197 / 352 to 61 / 556
+SB11 / 31515 / 24799 / 24491 / 308 / 103 / 331 to 56 / 436
+SB14 / 27492 / 17283 / 15435 / 1848 / 204 / 353 to 70 / 611
+SB15 / 31543 / 22571 / 22039 / 532 / 122 / 299 to 85 / 424
+SB16 / 28453 / 20081 / 18627 / 1454 / 206 / 333 to 84 / 627
+SB17 / 31424 / 19631 / 18938 / 693 / 104 / 338 to 87 / 402
-SB2 / 30947 / 15927 / 15510 / 417 / 89 / 295 to 88 / 346
-SB3 / 31445 / 19448 / 18407 / 1041 / 172 / 328 to 88 / 553
-SB6 / 29066 / 18989 / 18321 / 668 / 144 / 283 to 80 / 469
-SB8 / 35890 / 20588 / 20059 / 529 / 110 / 282 to 86 / 359
-SB11 / 40174 / 29811 / 29059 / 752 / 138 / 310 to 94 / 615
-SB14 / 38994 / 28876 / 26844 / 2032 / 208 / 336 to 53 / 683
-SB15 / 35737 / 24350 / 22804 / 1546 / 158 / 348 to 87 / 597
-SB16 / 38963 / 27136 / 26601 / 535 / 117 / 295 to 90 / 525
-SB17 / 45553 / 30751 / 29558 / 1193 / 200 / 298 to 85 / 615
SA2 / 34806 / 18817 / 16178 / 2639 / 133 / 296 to 85 / 469
SA3 / 31936 / 18523 / 16560 / 1963 / 170 / 294 to 85 / 484
SA6 / 34357 / 22302 / 20941 / 1361 / 164 / 307 to 52 / 634
SA8 / 31631 / 20589 / 19377 / 1212 / 168 / 300 to 70 / 532
SA11 / 12172 / 10245 / 10025 / 220 / 91 / 319 to 66 / 329
SA14 / 22105 / 18436 / 17622 / 814 / 99 / 305 to 68 / 480
SA15 / 37063 / 28511 / 26272 / 2239 / 218 / 342 to 78 / 672
SA16 / 43622 / 33384 / 28907 / 4477 / 204 / 300 to 50 / 697
SA17 / 22971 / 16851 / 16131 / 720 / 134 / 322 to 73 / 457

(a)Total sequences obtained for each sample after initial quality screening by Genome Quebec, where sequences which did not contain the complete pyrosequencing primer-tag sequence were removed.

(b)Final quality trimmed sequences (ITS extracted) submitted for clustering and identification

(c)Sequences with >97% similarity to database sequences

(d)Sequences without a good match to database sequences

(e)Total number of unidentified singletons (1-2 sequences) within the quality trimmed sequence pool

(f)Range of sequence lengths (bp’s) within each quality trimmed sequence pool, from longest to shortest

(g)Number of clusters generated during CD-Hit clustering at 98% similarity, using global alignment.

Table S4 Percent occurrence of the identified fungi within sequence dataset/

Sequence identity / Percent occurrence / Sequence identity / Percent occurrence / Sequence identity / Percent occurrence / Sequence identity / Percent occurrence / Sequence identity / Percent occurrence
Amphinema / 20.5134 / Lactarius / 0.2532 / Microbotryomycetes / 0.0730 / Lachnum / 0.0287 / Lecythophora / 0.0129
Mortierella / 18.7740 / Chalara / 0.2470 / Powellomyces / 0.0728 / Saccharomycetes / 0.0283 / Mrakiella / 0.0127
Piloderma / 9.0454 / Phoma / 0.2440 / Hypochnicium / 0.0723 / Sordariomycetes / 0.0274 / Herpotrichiellaceae / 0.0126
Unidentified ectomycorrhiza / 8.0438 / Agaricomycetes / 0.2371 / Mycoarthris / 0.0707 / Phaeosphaeria / 0.0271 / Lecanoromycetidae / 0.0124
Wilcoxina / 7.2201 / Sebacinaceae / 0.2338 / Phialophora / 0.0672 / Hirsutella / 0.0256 / Dothideomycetes / 0.0122
Unidentified fungus / 3.2449 / Gibberella / 0.2296 / Tetracladium / 0.0646 / Taphrina / 0.0249 / Hyphoderma / 0.0117
Tylospora / 2.7960 / Mortierellaceae / 0.2205 / Geomyces / 0.0644 / Leucosporidiella / 0.0246 / Meliniomyces / 0.0115
Cortinarius / 1.8626 / Guehomyces / 0.2191 / Cosmospora / 0.0622 / Dermateaceae / 0.0244 / Exophiala / 0.0114
Thelephoraceae / 1.6591 / Hypocrea / 0.2169 / Candida / 0.0612 / Umbelopsis / 0.0237 / Rhizoscyphus / 0.0114
Cenococcum / 1.3149 / Leptodontidium / 0.2166 / Sebacinales / 0.0596 / Articulospora / 0.0236 / Hypocreales / 0.0112
Thelephora / 1.1161 / Trichoderma / 0.2107 / Agaricomycetidae / 0.0592 / Mollisia / 0.0236 / Botrytis / 0.0104
Ceratobasidiaceae / 1.0666 / Cadophora / 0.1958 / Tomentellopsis / 0.0571 / Thysanophora / 0.0235 / Microdochium / 0.0102
Verticillium / 0.9127 / Basidiomycota / 0.1887 / Thelephorales / 0.0544 / Isaria / 0.0234 / Pucciniales / 0.0100
Helotiales / 0.8457 / Hygrocybe / 0.1729 / Pyronemataceae / 0.0515 / Sarcinomyces / 0.0232 / Pezizales / 0.0096
Agaricales / 0.7663 / Trichosporon / 0.1728 / Morchella / 0.0510 / Glarea / 0.0221 / Gyoerffyella / 0.0095
Cryptococcus / 0.7324 / Penicillium / 0.1511 / Hydnum / 0.0506 / Rhodocybe / 0.0208 / Davidiella / 0.0092
Zygomycete / 0.5418 / Glomus / 0.1449 / Xenochalara / 0.0475 / Sporobolomyces / 0.0205 / Atheliaceae / 0.0087
Inocybe / 0.5023 / Oidiodendron / 0.1336 / Tremellomycetes / 0.0434 / Fimetariella / 0.0202 / Rhizosphaera / 0.0076
Calycina / 0.4894 / Phialocephala / 0.1161 / Melanopsammella / 0.0414 / Venturia / 0.0201 / Helvella / 0.0073
Tuber / 0.4422 / Rhodotorula / 0.1137 / Rhizoctonia / 0.0412 / Mycena / 0.0192 / Chaetosphaeria / 0.0072
Hygrophorus / 0.3988 / Cystofilobasidium / 0.1136 / Pseudeurotium / 0.0391 / Psathyrella / 0.0167 / Hydropus / 0.0069
Pseudotomentella / 0.3829 / Cylindrocarpon / 0.1028 / Cystodendron / 0.0380 / Pochonia / 0.0165 / Dioszegia / 0.0067
Tomentella / 0.3754 / Alloclavaria / 0.1021 / Zalerion / 0.0353 / Glomeromycota / 0.0160 / Capronia / 0.0062
Cladosporium / 0.3647 / Hyaloscyphaceae / 0.1007 / Gyromitra / 0.0351 / Tremellales / 0.0159 / Botryotinia / 0.0059
Leotiomycetes / 0.3513 / Ceratobasidium / 0.1004 / Truncatella / 0.0319 / Hyphodontia / 0.0154 / Typhulaceae / 0.0059
Ascomycota / 0.3241 / Calyptrozyma / 0.0927 / Pseudogymnoascus / 0.0312 / Trechispora / 0.0151 / Alnicola / 0.0058
Sebacina / 0.3084 / Neonectria / 0.0853 / Peltigera / 0.0308 / Xenopolyscytalum / 0.0150 / Typhula / 0.0058
Lecanicillium / 0.3020 / Phialea / 0.0852 / Ascochyta / 0.0299 / Cortinariaceae / 0.0146 / Fusicladium / 0.0057
Russula cessans / 0.3013 / Cladophialophora / 0.0839 / Leptosphaeria / 0.0297 / Fibulorhizoctonia / 0.0135 / Microscypha / 0.0057
Herpotrichia / 0.2954 / Mucoromycotina / 0.0810 / Alternaria / 0.0294 / Leucosporidium / 0.0131 / Nectriopsis / 0.0057
Mrakia / 0.2782 / Pezizomycotina / 0.0795 / Tolypocladium / 0.0294 / Entoloma / 0.0129 / Galerina / 0.0053
Helotiaceae / 0.2555 / Varicosporium / 0.0765 / Thelebolales / 0.0292 / Fusarium / 0.0129 / Hyalodendriella / 0.0053
Sequence identity / Percent occurrence / Sequence identity / Percent occurrence / Sequence identity / Percent occurrence / Sequence identity / Percent occurrence / Sequence identity / Percent occurrence
Lyophyllum / 0.0052 / Lycoperdon / 0.0030 / Mycosphaerellaceae / 0.0015 / Blumeria / 0.0008 / Veluticeps / 0.0004
Ramariopsis / 0.0050 / Antarctomyces / 0.0029 / Pyrenochaeta / 0.0015 / Coprinellus / 0.0008 / Amphisphaeriaceae / 0.0003
Clavaria / 0.0048 / Beauveria / 0.0083 / Acremonium / 0.0014 / Gymnopilus / 0.0008 / Antrodiella / 0.0003
Hymenoscyphus / 0.0045 / Peltigerales / 0.0028 / Leptosphaerulina / 0.0014 / Magnaporthaceae / 0.0008 / Bacidia / 0.0003
Lecanoromycetes / 0.0045 / Scleroconidioma / 0.0027 / Cistella / 0.0013 / Rhizopogon / 0.0008 / Celosporium / 0.0003
Pluteus / 0.0045 / Allantophomopsis / 0.0025 / Coniochaeta / 0.0013 / Sordariales / 0.0008 / Chaetomella / 0.0003
Tremella / 0.0044 / Xenasmatella / 0.0025 / Gaertneriomyces / 0.0013 / Aspergillus / 0.0006 / Clavulina / 0.0003
Dactylella / 0.0043 / Helicoon / 0.0024 / Ulocladium / 0.0013 / Chaetothyriales / 0.0006 / Coccomyces / 0.0003
Epicoccum / 0.0043 / Cryptosporiopsis / 0.0023 / Antrodia / 0.0011 / Clathrosphaerina / 0.0006 / Colpoma / 0.0003
Filobasidium / 0.0043 / Thelebolus / 0.0023 / Discostroma / 0.0011 / Phaeococcomyces / 0.0006 / Coniophora / 0.0003
Sporormiella / 0.0043 / Acephala / 0.0021 / Geoglossaceae / 0.0011 / Verrucariales / 0.0006 / Coprinopsis / 0.0003
Lophodermium / 0.0042 / Bullera / 0.0021 / Lachnellula / 0.0011 / Amaurodon / 0.0005 / Exophiala / 0.0003
Pezizella / 0.0042 / Eurotiomycetes / 0.0021 / Oculimacula / 0.0011 / Botryobasidium / 0.0005 / Lindtneria / 0.0003
Stilbella / 0.0040 / Teberdinia / 0.0021 / Phanerochaete / 0.0011 / Cytidia / 0.0005 / Mastigobasidium / 0.0003
Ypsilina / 0.0039 / Agaricomycotina / 0.0020 / Preussia / 0.0011 / Diplomitoporus / 0.0005 / Nectria / 0.0003
Geoglossum / 0.0038 / Sclerotinia / 0.0020 / Rhytismataceae / 0.0011 / Haplographium / 0.0005 / Phacidiopycnis / 0.0003
Hyaloscypha / 0.0038 / Ampelomyces / 0.0019 / Collybia / 0.0010 / Junghuhnia / 0.0005 / Phellinus / 0.0003
Pichia / 0.0038 / Cantharellales / 0.0019 / Doratomyces / 0.0010 / Laccaria / 0.0005 / Pilidium / 0.0003
Scytalidium / 0.0038 / Ganoderma / 0.0023 / Embellisia / 0.0010 / Lophiostoma / 0.0005 / Pseudoplectania / 0.0003
Dermocybe / 0.0037 / Helgardia / 0.0019 / Glomerella / 0.0010 / Otidea / 0.0005 / Sistotrema / 0.0003
Exidiaceae / 0.0037 / Microbotryomycetidae / 0.0019 / Hebeloma / 0.0010 / Ramaria s / 0.0005 / Sporormia / 0.0003
Nectriaceae / 0.0034 / Pleosporales / 0.0019 / Leucosporidiales / 0.0010 / Skeletocutis / 0.0005 / Syzygospora / 0.0003
Ophiocordyceps / 0.0034 / Ramularia / 0.0019 / Lobulomyces / 0.0010 / Suillus / 0.0005 / Tricholomataceae / 0.0003
Alpova / 0.0033 / Hormonema / 0.0018 / Myxotrichaceae / 0.0010 / Arachnopeziza / 0.0004 / Trichophaea / 0.0003
Ambomucor / 0.0033 / Mortierellales / 0.0018 / Sepedonium / 0.0010 / Asterophora / 0.0004 / Acaulosporaceae / 0.0001
Clitopilopsis / 0.0033 / Mycosphaerella / 0.0018 / Byssonectria / 0.0009 / Cladonia / 0.0004 / Apodus / 0.0001
Cystoderma / 0.0033 / Pholiota / 0.0018 / Ilyonectria / 0.0009 / Hymenogaster / 0.0004 / Arrhenia / 0.0001
Hysterangium / 0.0033 / Rhizophagus / 0.0018 / Leccinum / 0.0009 / Lentinellus / 0.0004 / Arthrobotrys / 0.0001
Nolanea / 0.0033 / Rhodosporidium / 0.0018 / Mucor / 0.0009 / Mariannaea / 0.0004 / Asterotremella / 0.0001
Septoria / 0.0032 / Helicodendron / 0.0016 / Phaeosphaeriaceae / 0.0009 / Rhinocladiella / 0.0004 / Athelia / 0.0001
Tricholoma / 0.0032 / Venturiaceae / 0.0016 / Udeniomyces / 0.0009 / Thanatephorus / 0.0004 / Baeospora / 0.0001
Entrophospora / 0.0030 / Kuraishia / 0.0015 / Xeromphalina / 0.0009 / Trichaptum / 0.0004 / Basidiobolus / 0.0001
Sequence identity / Percent occurrence / Sequence identity / Percent occurrence / Sequence identity / Percent occurrence / Sequence identity / Percent occurrence / Sequence identity / Percent occurrence
Boletopsis / 0.0001 / Gloeophyllum / 0.0001 / Postia / 0.0001
Calocybe / 0.0001 / Hypholoma / 0.0001 / Pseudbakeri / 0.0001
Chytridiaceae / 0.0001 / Hypomyces / 0.0001 / Psilocybe / 0.0001
Clavicipitaceae / 0.0001 / Kappamyces / 0.0001 / Rhizophlyctis / 0.0001
Clitocybe / 0.0001 / Lophium / 0.0001 / Sarcodon / 0.0001
Coniothyrium / 0.0001 / Occultifur / 0.0001 / Sarcomyxa / 0.0001
Dactylaria / 0.0001 / Olpidium / 0.0001 / Seifertia / 0.0001
Dasyscyphus / 0.0001 / Panaeolus / 0.0001 / Stylonectria / 0.0001
Debaryomyces / 0.0001 / Paraphoma / 0.0001 / Sydowia / 0.0001
Didymella / 0.0001 / Placynthiella / 0.0001 / Trapeliopsis / 0.0001
Fontanospora / 0.0001 / Pleurophoma / 0.0001 / Trichocladium / 0.0001

Figure S3 Comparison of the taxonomic diversity at the order level in the different hyphal trap bags, sand barriers, and adjacent fermentation-humic layer of the forest floor. -SB, hyphal trap bags with no sand barrier; FH, in situ fermentation-humic layer; +SB, hyphal trap bags with sand barrier; sand, sand barrier; n = 9 each. The cluster analysis indicates the percent similarity of (based on Pearson’s r correlation) of the different communities at the class level.

Figure S4. Cenococcum tip PCR amplifications. All tips which produced multiple bands when PCR amplified were further evaluated by extraction and sequencing of all bands. All such tips contained Cenococcum ITS sequences, in association with Phialocephala europaea, Piloderma spp., Mycena sp, or Cadophora finlandica ITS sequences.

Figure S5. PCA ordination of enzyme activity in hyphal trap bags without a sand barrier (-SB), with a sand barrier (+SB), in adjacent forest floor (FH), and in sterile control hyphal trap bags. The proportion of variance explained by each axis is shown, and the contribution of each enzyme in the ordination is indicated by the plot vectors. Cel, Cellobiohydrolase; Glu, β-1,4-Glucosidase; N-Ag, β-1,4-N-Acetylglucosaminidase; Pho, Acid phosphatase; Sul,Sulfatase; Peptidase, Leucine aminopeptidase; Lac, Laccase; Perox, peroxidase.