Name / Sequence
RT-AM79-F / CACAACTGCGAGAAAGACCA
RT-AM79-R / GACATTTCCTGGCACCCTTA
RT-GAT-F / AACCCAATTAACGCTGAGGA
RT-GAT-R / AGCCATTCCCCTAAGTTGGT
RT-Actin-F / AAGGGATGCGAGGATGGA
RT-Actin-R / CAAGGAAATCACCGCTTTGG
Supplemental Table 2 The detected metabolites in transgenic tobacco plants
Metabolite / AM79 transgenic tobacco / Hybrid tobacco / GAT transgenic tobaccoControl / +glyphosate / P value / Control / +glyphosate / P value / Control / +glyphosate / P value
Lactic acid / 1210882 / 1289268 / 0.794679 / 787611 / 1088667 / 0.287111 / 577722 / 681362 / 0.254886
Acetic acid / 142128 / 463440 / 0.023332 / 147391 / 254800 / 0.372862 / 91007 / 238131 / 0.044583
l-Valine / 51830 / 551157 / 0.339754 / 179750 / 234862 / 0.453399 / 189267 / 281733 / 0.497161
l-Alanine / ND / 168502 / ND / 298096 / 183761 / 0.123652 / 303918 / 184850 / 0.488580
1,2-dihydroxy-cyclohexene / 8177366 / 16498221 / 0.071404 / 15315295 / 17483693 / 0.205576 / 58935321 / 18520948 / 0.518872
Oxalic acid / 1674115 / 629500 / 0.013776 / 830916 / 537123 / 0.134562 / 641765 / 546164 / 0.664937
Leucine / 57490 / 511010 / ND / 143442 / 275538 / 0.194805 / 156518 / 186476 / 0.603796
Glycine / ND / 128245 / ND / 125756 / 148670 / 0.506961 / 110614 / 110199 / 0.994316
Serine / 91066 / 651851 / ND / 498232 / 629379 / 0.434620 / 1660085 / 591130 / 0.350390
β-Amino isobutyric acid / 116653 / 959458 / ND / 694083 / 840869 / 0.481104 / 675628 / 881823 / 0.332163
Phosphate / 15319815 / 17039646 / 0.716752 / 17581716 / 15966621 / 0.590340 / 12249971 / 14188891 / 0.688439
l-Threonine / ND / 908914 / ND / 531589 / 641208 / 0.537759 / 1007304 / 851154 / 0.843154
Succinic acid / 73600 / 543305 / 0.046209 / 534146 / 375635 / 0.223781 / 1397333 / 302964 / 0.390700
Glyceric acid / 1147853 / 6480326 / 0.000737 / 1961208 / 3080493 / 0.349058 / 728945 / 2266339 / 0.081518
Fumaric acid / 109208 / 191737 / 0.127318 / 416713 / 157636 / 0.155468 / 501426 / 246594 / 0.558971
Nicotine / 1966347 / 3324222 / 0.039679 / 6998399 / 4081691 / 0.248544 / 5998067 / 2053436 / 0.007467
L-threonine / ND / 106188 / ND / 70996 / 71014 / 0.999498 / 165929 / 83101 / 0.572299
Decanedioic acid / 125173 / 22774 / 0.026099 / 48101 / 43744 / 0.829387 / 95642 / 37844 / 0.128553
Cadaverine / 131997 / 2075220 / ND / 1845865 / 2455035 / 0.097017 / 2277138 / 2529328 / 0.710299
4-N-methylaminobutyric acid / 644131 / 7107277 / 0.001002 / 6441582 / 9264887 / 0.078232 / 8073292 / 9073077 / 0.731523
4-Ketoglucose / 201466 / 34858 / ND / 179918 / 40058 / 0.155383 / 53959 / 18427 / 0.213718
Malic acid / 10427454 / 19728039 / 0.333257 / 14014903 / 16484795 / 0.766564 / 3455173 / 19466169 / 0.005482
Supplemental Table 2 continued
metabolite / AM79 transgenic tobacco / Hybrid tobacco / GAT transgenic tobaccoControl / +glyphosate / P value / Control / +glyphosate / P value / Control / +glyphosate / P value
Pyroglutamic acid / 75568 / 491999 / 0.220486 / 209776 / 641154 / 0.027227 / 2346643 / 2029326 / 0.890165
4-aminobutyric acid / 43011 / 2909122 / ND / 1858832 / 3041277 / 0.181013 / 2301679 / 4640909 / 0.418350
2-methyl-2,3-dihydroxy-Propanoic acid / 18788 / 3113012 / 0.247221 / 18788 / 1409481 / 0.161070 / 18788 / 2995740 / 0.022307
2,3,4-Trihydroxybutyric acid / 403064 / 2870638 / 0.039249 / 2091153 / 878525 / 0.205593 / 1905867 / 902749 / 0.604623
Methylmalonic acid / ND / 36467 / ND / 63218 / 67080 / 0.897464 / 107635 / 35434 / 0.226760
Xylonic acid / 78697 / 181479 / 0.101831 / 166002 / 123902 / 0.405138 / 116699 / 85580 / 0.540033
Xylose / 82286 / 427077 / 0.080295 / 118917 / 185135 / 0.208745 / 98445 / 160604 / 0.300925
Erythrose / 139519 / 512380 / 0.027758 / 334991 / 358457 / 0.831223 / 290034 / 370528 / 0.556084
Ribose / 5893564 / 6219650 / 0.861287 / 8054563 / 5461359 / 0.168853 / 5625281 / 4077786 / 0.285659
xylitol / 127072 / 283696 / 0.002162 / 168204 / 148687 / 0.739057 / 144435 / 154825 / 0.811192
Ribitol / 61120 / 170361 / 0.004041 / 104598 / 111067 / 0.878587 / 67147 / 92423 / 0.213194
Arabinofuranose / 49413 / 296473 / 0.015178 / 49278 / 112899 / 0.238656 / 69441 / 62352 / 0.676864
D-Glucitol / 152272 / 127501 / ND / 200023 / 111264 / 0.054529 / 228195 / 531115 / ND
shikimic acid / 254518 / 556735 / 0.001962 / 317136 / 296419 / 0.844111 / 194954 / 19845998 / 0.005272
Tetradecanoic acid / 114474 / 669748 / 0.001994 / 154878 / 375772 / 0.271737 / 108022 / 250683 / 0.041669
Octanedioic acid / 549753 / 1944901 / 0.013433 / 2164635 / 1641448 / 0.459338 / 1403065 / 1857204 / 0.612200
D-Fructose / 10932583 / 39829046 / 0.000014 / 24146991 / 32819450 / 0.190928 / 16297545 / 29606352 / 0.120067
Galactose / 2422107 / 987434 / 0.181121 / 2414110 / 1510653 / 0.005313 / 2060010 / 1514987 / 0.075044
Glucose / 20025826 / 75469190 / 0.000593 / 37256703 / 48587611 / 0.246404 / 29396958 / 27912142 / 0.888764
Glucitol / 5871062 / 29720508 / 0.000236 / 12695947 / 17238712 / 0.315307 / 8645480 / 14746200 / 0.168875
Glycoside / 61822 / 1597733 / 0.005778 / 61822 / 1337602 / 0.021461 / 53627.5 / 1552281 / 0.0106779
Supplemental Table 2 continued
metabolite / AM79 transgenic tobacco / Hybrid tobacco / GAT transgenic tobaccoControl / +glyphosate / P value / Control / +glyphosate / P value / Control / +glyphosate / P value
Mannonic acid / 110219 / 927186 / 0.024613 / 333438 / 486871 / 0.420074 / 314111 / 345196 / 0.868002
Glucopyranose / 21798 / 600850 / 0.029927 / 82550 / 235682 / 0.194321 / 159490 / 296927 / 0.313469
Palmitelaidic acid / 172170 / 217987 / 0.384332 / 200853 / 201015 / 0.998148 / 324554 / 152310 / 0.182950
Palmitic acid / 1270586 / 2289725 / 0.051871 / 2049750 / 1413685 / 0.133847 / 1796851 / 1350613 / 0.057622
N-Acetyl glucosamine / 85146 / 128928 / 0.303249 / 122993 / 85762 / 0.291419 / 134875 / 75467 / 0.129676
Inositol / 9939885 / 30171996 / 0.000087 / 17981323 / 30164367 / 0.104211 / 10531551 / 17515892 / 0.096004
Sedoheptulose / 623836 / 1278277 / 0.021020 / 792905 / 802936 / 0.967554 / 685181 / 633119 / 0.786956
Unknown / 208133 / 656994 / 0.054812 / 325103 / 360044 / 0.729469 / 225574 / 1192792 / 0.035321
β-D-Glucopyranose / 44048 / 89906 / 0.079965 / 57854 / 68004 / 0.622469 / 52025 / 103906 / 0.293664
Linolenic acid / 347616 / 1153829 / 0.035437 / 806556 / 825897 / 0.951738 / 755963 / 489586 / 0.337129
Stearic acid / 228498 / 405493 / 0.026501 / 354403 / 340842 / 0.742528 / 320564 / 229726 / 0.143670
Steroid / 1087536 / 1954438 / 0.134464 / 1568237 / 1445972 / 0.737742 / 1414097 / 990870 / 0.077510
2-O-Glycerol-α-d-galactopyranoside / 3081332 / 4247405 / 0.286486 / 5175753 / 3167671 / 0.132632 / 4720188 / 3189844 / 0.241542
D-Glycero-D-gulo-Heptose / 223421 / 598386 / 0.029030 / 374283 / 342651 / 0.846161 / 252623 / 85639 / 0.044615
Uridine / 86057 / 300022 / 0.128481 / 220796 / 192560 / 0.687111 / 276848 / 171724 / 0.436708
Mannose / 496409 / 1471202 / 0.113759 / 162053 / 655698 / 0.182292 / 982574 / 643802 / 0.623776
Melibiose / 7598416 / 9747867 / 0.174515 / 10978869 / 8242856 / 0.261636 / 7046040 / 5807229 / 0.605878
ND means not detectable.Statistical P value calculated using a two sample T-Test.
Supplemental Fig. 1 Schematic diagram of GAT transgenic locus
Supplemental Fig. 2 Glyphosate tolerance of transgenic tobacco seedlings on plates containing 2 mM glyphosate.
T1 tobacco seeds were germinated on the MS medium containing 10 mg L-1 PPT and grown for 7 days. The live seedlings were transferred to MS medium on plates containing 2 mM glyphosate. Photographs were taken two weeks later, and the fresh weight was measured at the same time.
Supplemental Fig. 3 Shikimate contents in tobacco plants after glyphosate treatment
Changes in the value of shikimate in hybrids and single gene transformants response to glyphosate stress. Experimental data was tested by students’ t-test analysis at P<0.01 or P<0.05 level. Data are shown as the average ± S.D. of six biological replicates.