Supplementary Information 1

Supplementary information 1.

Animals and treatment

In the present study heterozygous human TNF transgenic mice (hTNFtg, strain tg197; genetic background C57BL/6) were employed. For all the experiment only females and littermates were used. A total of 42 animals were included in the study.

For genotyping the hTNFtg animals the following primer was used: 5′-TACCCCCTCCTTCAGACACC-3′ and 5′-GCCCTTCATAATATCCCCCA-3′.

Transgenic hTNF mice develop a chronic inflammatory and destructive polyarthritis as well as severe osteopenia starting at 4-6 weeks of age. Six weeks old hTNFtg mice were divided into 6 groups (n=6/group) and treated for 4 weeks according to the following protocol: group 1 received phosphate buffered saline (PBS; vehicle) as a control, group 2 received an anti-TNF antibody (10mg/kg infliximab, Centocor Leiden, The Netherlands), group 3 received a rat Dkk-1 antibody (10mg/kg, Amgen, Thousand Oaks, CA), group 4 received anti-Dkk-1 (30mg/kg), group 5 received anti-TNF (10mg/kg) plus anti-Dkk-1 (10 mg/kg) and group 6 anti-TNF (10mg/kg) plus anti-Dkk-1 (30mg/kg). Untreated wild-type littermates were used as positive control.

Antibodies were administrated by intraperitoneal injection three times per week. At the end of the treatment, mice were killed by cervical dislocation under general anaesthesia. All animal procedures were approved by the local ethics committee of the University of Erlangen-Nuremberg.

Histological Analysis and Histomorphometry

Tibial bones were carefully prepared and fixed overnight in 4.0% formalin and then embedded undecalcified in methylmetacrylate (Technovit; Heraeus Kulzer, Wehrheim, Germany). After polymerization, 3-4 µm sections were cut with a Jung micrometer (Jung Heidelberg, Germany), deplastinated in methoxymethylmetacrylate (Merck, Darmstadt, Germany). Sections were stained with von Kossa for bone morphology and Goldner for bone morphology and osteoblast assessment. Right tibiae were additionally fixed in paraformaldehyde 4% overnight and then decalcified using an EDTA buffer. Paraffin sections were stained with haematoxylin and eosin as well as tartrate resistant acid phosphatase (TRAP) for osteoclast assessment. Bone histomorphometry was performed using a microscope (Nikon, Japan) equipped with a video camera and digital analysis system (OsteoMeasure, OsteoMetrics; Decatur, CA). The followings parameters were measured: The fraction of bone volume per total sample volume (bone volume/tissue volume (BV/TV)), trabecular number (Tb. N.), trabecular thickness (Tb. Th.),osteoclast surface per bone surface (Oc.S/BS) and osteoblast surface per bone surface (Ob.S/BS).

Dynamic labelling of bone

In vivo bone formation was assessed by dynamic histomorphometry: 0.3 mg calcein (Sigma-Aldrich) was injected subcutaneously 9 and 2 days before mice were sacrificed. Undecalcified sections were used for analysis. The entire marrow region within the cortical shell was assessed by fluorescent microscopy and mineral apposition rate (µm/day; MAR) was determined.

Immunohistochemistry

Paraffin-embedded sections were deparaffinised, hydrated and incubated with PH6 citrate buffer for antigen retrieval. Samples were incubated overnight with a rabbit anti-β-catenin antibody (Santa Cruz) or goat anti-sclerostin antibody (R&D Systems). Appropriate secondary antibodies were used and detection performed with Fast-Red TR/Naphtol (Sigma) resulting in red staining of antigen expressing cells (β-Catenin) or with Vecstatin ABC (Vector) and 3´3- diaminobenzidine (DAB; Sigma) as chromogen resulting in brown staining of antigen expressing cells (sclerostin).

Quantitative reverse transcription-polymerase chain reaction (RT-PCR)

RNA was isolated from left femurs and cultured primary osteoblasts using Trizol (Invitrogen). Quantitative reverse transcriptase-PCR was performed using SYBR Green. The expression of the target molecule was normalized to the expression of β-actin.Untreated wildtype mice then served as reference value for comparison between groups and no amplification factor was used for relative mRNA calculation. The data is expressed using arbitrary units.The following primers were used: β-actin: for 5´TGT CCA CCT TCC AGC AGA TGT 3` rev. 5` AGC TCA GTA ACA GTC CGC CTA GA 3`; Osteocalcin: for. 5´CTGACCTCACAGATCCCAAGC 3´ rev. 5` TGGTCTGATAGCTCGTCACAAG 3`; Osteoprotegerin: for. 5` AGC TGC TGA AGC TGT GGA A 3` rev. 5` GGT TCG AGT GGC CGA GAT 3`;Dkk-1 for. 5`CTGAAGATGAGGAGTGCGGCTC 3` rev. 3` GGCTGTGGTCAGAGGGCA5` and Sclerostin for 5`AGCCTTCAGGAATGATGCCAC 3` rev 5 ` CTTGGCGTCATAGGGATGGT 3´.

Cell culture

Primary osteoblasts were isolated from the calvariae 4-6 day old wild-type mice by collagenase digestion. Cells were seeded at a density of 12 000 cells/cm² and cultured until confluence in αMEM (A10490-Gibco) supplemented with 10 % fetal calf serum, 1 % penicillin & streptomycin, 50µg/ml ascorbic acid and 10mM β-glycerophosphate for 21 days. For functional analysis, cells were stimulated with recombinant murine TNF (10 ng/ml, R&D Systems), recombinant Dkk-1 (50 ng/ml, R&D Systems)or anti-Dkk-1 antibody (1µg/ml, Amgen).

ELISA Analysis

Supernatants were analyzed using a commercial ELISA kit for Dkk-1 (R&D Systems, Minneapolis) following manufacturer instructions and an ELISA for Sclerostin established in our laboratory: Ninety-six-well ELISA plates (Costar, Corning, USA) were coated with 1µg/ml capture antibody (anti mSOST AF 1589 (R&D)) diluted in PBS at 4°C overnight. Plates were washed three times with 300μl/well 0.05% Twin in PBS, and then blocked with 250 μl/well 2% BSA in PBS for 1hour at room temperature. After washing, 100μl/well standards, controls or samples were then added in duplicate to the plates. The plates were incubated at room temperature for 2h. After washing, 100μl/well of the detector antibody (400ng/ml anti m-SOST BAF 1589 (R&D)) diluted in 0.1 % BSA in PBS was added to the plates, which were incubated for 2 hours at room temperature. After washing, the plates were incubated in the dark for 20 minutes at room temperature with 100µl /well Streptavidin HRP (R&D) diluted in 0.1 % BSA in PBS. After final washing, the plates were developed for 20 minutes at room temperature in the dark with Tetramethylbenzydin (TMB) Substrate (R&D). The reaction was stopped by adding 100μl/well hydrochloric acid (R&D) and the absorbance was read at 450nm using an ELISA plate reader (Molecular Devices, Spectramax 190).

Statistical analysis

Data are presented as the mean ± SEM. For group comparison, we used one-way factorial analysis of variance with the Dunnett test or the Mann-Whitney test. A p value <0.05 was considered significant.