Supplemental Table S1. Primer sequences
Candidate genes / SNP / Sense Primer / Anti-sense PrimerSlc27a5 / rs6197012 / TCATTGCTGACCCCCTCTAC / CAGCACTGAACAGCTGCATT
Slc27a5 / rs6211510 rs6211509 / ccagctcagagtgaccagtg / ttcccttatccacctactcctg
Sae1 / rs48060503 / GAATTGTGGAGTGCCTTGGT / TTGGGCTGAAAAGATGGTTC
Cyp2d26 / rs50377862 / gaaagaaaagcaactggacctg / tctacccatctggcatcaca
Tspo / rs13459641 / CACCCACCAGGAATAAGTGG / GGCAAGCAGGAAAAAGTTCA
Supplemental Table S2. Gene expression results in the F2 mice
Significant a / Suggestive a / Total a / TG / TG
Males+Females / 282 / 2,840 / 1,411 / 4,251 / 631 / 433
Males / 142 / 2,095 / 1,304 / 3,399 / 671 / 347
Females / 135 / 1,907 / 1,243 / 3,150 / 622 / 201
a The eQTL analysis was performed at the transcript level. Only one transcript is reported per gene based on the highest cis QTL LOD score. Genome-wide significance levels were determined by permuting the observed data 10,000 times. The significant thresholds for the eQTL analysis are 3.6 for the autosomes in the combined sex, male and female analyses, and 2.7, 2.7 and 2.8 for the X chromosome in the combined sex male and female analyses respectively. The suggestive thresholds are 2.2 for the autosomes in the combined sex male and female analyses respectively, and 1.4, 1.4 and 1.5 for the X chromosome in the combined sex, male and female analyses respectively.
b Number of genes correlated with triglyceride level. The correlation was calculated over the entire population (males and females), female only or male only after adjusting the rank Z transformed phenotype for sex in the combined sex analysis. We used a cut-off p-value of 0.05 for the difference in expression between the parental strains and for the correlation (Person’s correlation).
c Number of genes differentially expressed in males or females, cis-regulated and for which the expression was also correlated with triglyceride levels.
2
Supplemental Table S3. Top 50 genes genome-wide correlated with triglycerides in males and females
Males +Females / Males only / Females onlyGene a / Chr / Pos. (Mb) / Correlation r (p-value) b / Gene a / Chr / Pos. (Mb) / Correlation r (p-value) b / Gene a / Chr / Pos. (Mb) / Correlation r (p-value) b
Ttll12 / 15 / 83.4 / 0.27 (<0.001) / Slc27a5 / 7 / 13.6 / 0.34 (<0.001) / Ttll12 / 15 / 83.4 / 0.36 (<0.001)
Jub / 14 / 55.2 / 0.25 (<0.001) / Hamp2 / 7 / 31.7 / 0.33 (<0.001) / A1bg / 15 / 60.7 / 0.34 (<0.001)
Aof1 / 13 / 47.1 / 0.25 (<0.001) / Kcnk10 / 12 / 99.7 / 0.33 (<0.001) / Mdfic / 6 / 15.7 / -0.32 (<0.001)
Cyp2d26 / 15 / 82.6 / 0.24 (<0.001) / AC142244.1 / 1 / 169.2 / 0.32 (<0.001) / Cyp2d22 / 15 / 82.2 / -0.32 (<0.001)
Mdfic / 6 / 15.7 / -0.24 (<0.001) / Cyp2j5 / 4 / 96.3 / 0.32 (<0.001) / Adra1b / 11 / 43.6 / 0.32 (<0.001)
Kcnk10 / 12 / 99.7 / 0.24 (<0.001) / Nat9 / 11 / 115 / 0.31 (<0.001) / 1110028A07Rik / 14 / 56.2 / -0.32 (<0.001)
BC048355 / 17 / 46.6 / 0.24 (<0.001) / Cblb / 16 / 52 / -0.31 (<0.001) / Slc39a2 / 14 / 52.5 / -0.32 (<0.001)
Rangap1 / 15 / 81.5 / -0.24 (<0.001) / Hmox1 / 8 / 77.6 / -0.31 (<0.001) / Cask / X / 13.1 / 0.31 (<0.001)
Gypc / 18 / 32.7 / 0.23 (<0.001) / Lipc / 9 / 70.6 / 0.31 (<0.001) / Rab5b / 10 / 128.1 / 0.3 (<0.001)
Car14 / 3 / 95.7 / 0.23 (<0.001) / Muted / 13 / 38.7 / 0.3 (<0.001) / Polr3h / 15 / 81.7 / -0.3 (<0.001)
Slc25a17 / 15 / 81.1 / -0.23 (<0.001) / Cyp2a12 / 7 / 27.8 / 0.3 (<0.001) / Tspo / 15 / 83.4 / -0.29 (0.001)
A1bg / 15 / 60.7 / 0.23 (<0.001) / 1110008L16Rik / 12 / 56.4 / 0.3 (<0.001) / Cyp2d13 / 15 / 82.5 / -0.28 (0.001)
Camk1d / 2 / 5.2 / 0.22 (<0.001) / Tapbp / 17 / 34.1 / -0.3 (<0.001) / Camk1d / 2 / 5.2 / 0.28 (0.001)
Gatm / 2 / 122.4 / -0.22 (<0.001) / Itgal / 7 / 134.5 / -0.3 (<0.001) / Decr2 / 17 / 26.2 / -0.28 (0.001)
Hamp2 / 7 / 31.7 / 0.22 (<0.001) / Tceal8 / X / 132.7 / 0.29 (<0.001) / Isoc1 / 18 / 58.8 / 0.28 (0.001)
Ptgr2 / 12 / 85.6 / 0.22 (<0.001) / Tbc1d15 / 10 / 114.6 / -0.29 (<0.001) / Hif1a / 12 / 75 / 0.28 (0.001)
Asrgl1 / 19 / 9.2 / 0.22 (<0.001) / Arrb2 / 11 / 70.2 / -0.29 (<0.001) / BC048355 / 17 / 46.6 / 0.28 (0.001)
Pex10 / 4 / 154.4 / 0.21 (<0.001) / Aof1 / 13 / 47.1 / 0.28 (0.001) / Slc25a17 / 15 / 81.1 / -0.27 (0.001)
Slc10a1 / 12 / 82.1 / 0.21 (<0.001) / C4a / 17 / 34.9 / -0.28 (0.001) / Gypc / 18 / 32.7 / 0.27 (0.001)
Cyp2a12 / 7 / 27.8 / 0.21 (0.001) / Sirpa / 2 / 129.4 / -0.28 (0.001) / Lrrc24 / 15 / 76.5 / -0.27 (0.001)
8030423J24Rik / 13 / 71 / 0.21 (0.001) / Grn / 11 / 102.3 / -0.28 (0.001) / Rangap1 / 15 / 81.5 / -0.27 (0.002)
Isoc1 / 18 / 58.8 / 0.2 (0.001) / Reep5 / 18 / 34.5 / -0.28 (0.001) / Pcolce2 / 9 / 95.5 / 0.27 (0.002)
Igfals / 17 / 25 / 0.2 (0.001) / Rgl1 / 1 / 154.4 / -0.27 (0.001) / Ankrd13a / 5 / 115.2 / 0.27 (0.002)
Polr3h / 15 / 81.7 / -0.2 (0.001) / Lgals3bp / 11 / 118.3 / -0.27 (0.001) / Jub / 14 / 55.2 / 0.26 (0.002)
AC142244.1 / 1 / 169.2 / 0.2 (0.001) / Lgmn / 11 / 70.2 / -0.27 (0.001) / Rbm9 / 15 / 76.9 / -0.26 (0.002)
Cyp2d13 / 15 / 82.5 / -0.2 (0.001) / Ptgr2 / 12 / 85.6 / 0.27 (0.001) / Cyp2d26 / 15 / 82.6 / 0.26 (0.002)
Acad9 / 3 / 36 / 0.2 (0.001) / C2 / 17 / 35 / -0.27 (0.001) / Ccdc142 / 6 / 83.1 / 0.26 (0.003)
Syde2 / 3 / 145.7 / 0.2 (0.001) / Map3k15 / X / 156.4 / 0.27 (0.001) / Enpep / 3 / 129 / 0.25 (0.003)
Tspo / 15 / 83.4 / -0.2 (0.001) / Lcp2 / 11 / 33.9 / -0.27 (0.001) / Wdr23 / 14 / 56.2 / 0.25 (0.003)
Cyp39a1 / 17 / 43.8 / -0.2 (0.001) / Iigp2 / 11 / 58 / -0.26 (0.001) / Hsd17b4 / 18 / 50.3 / -0.25 (0.003)
Fam13a / 6 / 58.9 / 0.2 (0.001) / Rod1 / 4 / 59.5 / -0.26 (0.001) / Alkbh2 / 5 / 114.6 / -0.25 (0.003)
Cyp2d22 / 15 / 82.2 / -0.2 (0.001) / Gnmt / 17 / 46.9 / 0.26 (0.001) / Masp1 / 16 / 23.4 / 0.25 (0.003)
Muted / 13 / 38.7 / 0.2 (0.001) / Fxc1 / 7 / 112.8 / 0.26 (0.001) / Olfml1 / 7 / 114.7 / 0.25 (0.003)
Ebag9 / 15 / 44.5 / 0.2 (0.001) / Aarsd1 / 11 / 101.3 / 0.26 (0.001) / Ammecr1l / 18 / 31.9 / 0.25 (0.003)
Chd1l / 3 / 97.4 / 0.2 (0.001) / Arl8a / 1 / 137 / -0.26 (0.002) / Cyp2d10 / 15 / 82.2 / -0.25 (0.004)
Pon2 / 6 / 5.2 / -0.2 (0.001) / Snx30 / 4 / 59.8 / -0.26 (0.002) / Phyh / 2 / 4.8 / -0.25 (0.004)
Rnase4 / 14 / 51.7 / -0.2 (0.001) / Sae1 / 7 / 16.9 / 0.26 (0.002) / Galntl4 / 7 / 118.6 / 0.25 (0.004)
Lrrc24 / 15 / 76.5 / -0.2 (0.001) / Pex10 / 4 / 154.4 / 0.26 (0.002) / BC031353 / 9 / 74.9 / 0.25 (0.004)
4430402I18Rik / 19 / 29 / 0.19 (0.001) / Slc10a1 / 12 / 82.1 / 0.26 (0.002) / Cyp2d9 / 15 / 82.3 / -0.25 (0.004)
Gldc / 19 / 30.2 / 0.19 (0.001) / Cdk6 / 5 / 3.3 / -0.26 (0.002) / Fam13a / 6 / 58.9 / 0.25 (0.004)
Arrb2 / 11 / 70.2 / -0.19 (0.001) / Zmynd11 / 13 / 9.7 / 0.25 (0.002) / Rabl4 / 15 / 78 / 0.25 (0.004)
Mccc1 / 3 / 35.9 / 0.19 (0.001) / 1500003O22Rik / 7 / 112.9 / 0.25 (0.002) / Cyp2r1 / 7 / 121.7 / 0.25 (0.004)
Ndufaf1 / 2 / 119.5 / 0.19 (0.001) / Rpn2 / 2 / 157.1 / -0.25 (0.002) / Tmem165 / 5 / 76.6 / -0.25 (0.004)
Ankrd13a / 5 / 115.2 / 0.19 (0.001) / Asb7 / 7 / 73.8 / 0.25 (0.002) / Pnp1 / 14 / 51.6 / -0.25 (0.004)
Dock4 / 12 / 41.2 / 0.19 (0.001) / Itk / 11 / 46.1 / -0.25 (0.002) / Rtn3 / 19 / 7.5 / -0.24 (0.005)
Sdcbp / 4 / 6.3 / -0.19 (0.001) / Dcxr / 11 / 120.6 / 0.25 (0.002) / Aof1 / 13 / 47.1 / 0.24 (0.005)
Rpgrip1 / 14 / 52.8 / 0.19 (0.001) / Trub1 / 19 / 57.5 / 0.25 (0.002) / Fzd7 / 1 / 59.5 / 0.24 (0.006)
Mthfd1l / 10 / 6.2 / -0.19 (0.001) / Itgb2 / 10 / 77 / -0.25 (0.002) / AC122193.2 / 6 / 134.9 / 0.24 (0.006)
Gnmt / 17 / 46.9 / 0.19 (0.001) / Slc6a6 / 6 / 91.6 / -0.25 (0.003) / Slco2b1 / 7 / 106.8 / 0.24 (0.006)
Fzd6 / 15 / 38.8 / -0.19 (0.001) / Eif3g / 9 / 20.7 / 0.25 (0.003) / Chd1l / 3 / 97.4 / 0.24 (0.006)
a Bold indicates genes located within the confidence interval of a QTL.
b Triglyceride level was rank-Z transformed and adjusted for sex in the combined sex analysis. We used a cut-off p-value of 0.05 for the correlation (Person’s correlation).
4
Supplemental Table S4. Cis-regulation of the probes within Slc27a5, Sae1, Polr3h, Cyp2d26, Ttll12, and Tspo.
Gene a / Probe ID / Cis-QTLPosition (LOD) b / Known SNP
within probe target? c / Polymorphism
MRL vs SM? d
Slc27a5 / 863226 / (30.7) / rs6197012 / MRL ≠ SM d
1028784 / (38.4) / rs6197012 / MRL ≠ SM d
973892 / (5.9)
742312 / (5)
49849 / (6.3)
614925 / (14.8)
575387 / (6.5) / rs6211510, rs6211509 / MRL = SM d
687569 / (6.9) / rs39831086 / MRL = SM
877761 / (3.5)
974092 / ns
485765 / (11)
505311 / (8.7)
591213 / (8.9)
555169 / (14.3)
165313 / (4.1)
680084 / (3.5)
158395 / (16.4)
774262 / (11.9) / rs36881586 / MRL = SM
384403 / (13)
526932 / (18.9)
146345 / (10.1)
422188 / (9.2)
158254 / (19.1)
1013080 / (10.3)
319725 / (6.3)
824332 / (13.6)
127138 / (4.5)
490921 / (8.8)
490398 / (6.3)
1030464 / (19.7)
410788 / (6.1)
462863 / (12)
1064514 / (3)
644002 / (2.9)
392671 / (5.7)
Sae1 / 255665 / (10.9)
292307 / (58.7)
451838 / ns / rs48060503 / MRL ≠ SM d
953762 / (73)
301389 / (73.5)
1055321 / (64.9)
654568 / (79.4)
105273 / (75.1)
162654 / (41.4)
284699 / (63.8)
703402 / (70.5)
22520 / (73.6) / rs36457731 / MRL = SM
881526 / (77) / rs36457731 / MRL = SM
597213 / (54.5)
1087224 / (61.1)
14420 / (65.9)
465657 / (10.1)
128705 / (59.3)
1077059 / (50.6)
182443 / (7.4)
493520 / ns
619066 / (3.7)
9499 / ns
936279 / ns
Polr3h / 330849 / ns
625236 / ns
983483 / ns
351152 / (27.6)
852209 / (6)
348163 / (11.1)
267500 / (4.5)
601214 / (6)
889788 / (13.6)
824227 / ns
514212 / (3.4)
718092 / (3.7)
619536 / ns
871579 / ns
384232 / ns
405121 / (8.4) / rs31669011 / MRL = SM
518883 / (5.3) / rs31669011 / MRL = SM
518553 / (5.5) / rs31669011 / MRL = SM
9710 / (13.8)
211556 / (14.1)
645920 / (24.6)
89075 / (24.5)
1002099 / (39.4)
604036 / (41.4)
862842 / (7)
861217 / ns
1069696 / (2.9)
Cyp2d26 / 1054860 / (3.7)
85685 / (10)
285645 / (10.8)
956018 / (10.7)
613092 / (12.4)
365667 / (6.8)
234448 / (10.6) / rs31696902 / MRL = SM
868370 / (5.6)
62713 / (19.3)
1055095 / (15.4)
363458 / (10.6)
64302 / (70.1) / rs31697890 / MRL = SM
63353 / (10.4)
551342 / (9.4) / rs50377862 / MRL = SM d
911813 / (13.4) / rs31698791 / MRL = SM
51932 / (9.9)
689588 / (14.2) / rs31698793 / MRL = SM
421449 / (10.5)
200165 / (13)
1079846 / (10.2)
922108 / (10.2)
535709 / (9.8)
493254 / (9.1)
720380 / (4.2)
Ttll12 / 330117 / (5.2)
76239 / (6.3)
161642 / (9.9)
73245 / (16) / rs31720344 / MRL = SM
767761 / (7.2)
237139 / (11.1)
875734 / (11.3)
860770 / (23.8)
935168 / (15.5)
421871 / (8.7)
421318 / (22.4)
539962 / (9.9)
485211 / (4.4)
351659 / (9.9)
1058996 / (3.8)
183884 / ns
714110 / (2.8)
1052291 / (2.8) / rs31719207 / MRL = SM
345528 / (8.9)
222122 / (5.6)
1045809 / (3.5)
526570 / ns
868882 / ns
918904 / ns / rs31717119 / MRL ≠ SM d
224732 / ns
Tspo / 672273 / ns
1058244 / ns
579603 / ns
877316 / (4.5)
165223 / (3.1) / rs13459641 / MRL = SM d
937447 / (6.6)
708218 / (4.7)
837555 / ns
79381 / (7.5)
499032 / (5.6)
126823 / (5.6)
172704 / (6.4)
962978 / (4.8)
618191 / (8.5)
790653 / ns
748418 / (7.8)
397755 / (4.9)
1057346 / ns
132405 / ns / rs31714043 / MRL = SM
276930 / (5.9)
670307 / ns
381815 / (3)
96598 / ns
1075992 / ns
1093706 / ns
Abbreviations: Chr, Chromosome; ns, non significant
a Among the eight candidate genes, six had polymorphisms within probe binding sites that vary between MRL and SM.
b QTL analysis was performed using R/qtl. Sex was added as an addititve covariate. A cis QTL was defined as a QTL with a peak located within 20 cM of the gene position and with a LOD score either significant (P < 0.05) or suggestive (P < 0.63).
c SNPs reported in the Ensembl database and located within a probe binding site.
d Genotype comparison between MRL and SM for the SNPs located within a probe binding site. The imputed CGD database was used to identify the genotype except for rs31717119within Ttll12, rs50377862 within Cyp2d26, rs6197012 and rs6211510 within Slc27a5, rs48060503 within Sae1 and rs13459641 within Tspo that were not present in the CGD database and for which we resequenced both strains (MRL and SM) to identify the alleles.
8
Supporting Table S5. Evidence for Ppara as a candidate gene for Tgq35 in the MRLxSM cross.
Transcripts / Cis eQTL location Cis (LOD) a / Strain comparisonFold Change (P-Value) b / Correlation
R (P-Value) c
Male+Female / Male / Female / Male / Female / Male+Female / Male / Female
Ppara
ENSMUST00000057979 / (6.6) / (6.9) / ns / 2.14 (<0.001) / 1.46 (0.026) / -0.11 (0.067) / -0.11 (0.169) / -0.09 (0.321)
ENSMUST00000109422 / (6.3) / (6.4) / ns / 2.09 (<0.001) / 1.46 (0.029) / -0.07 (0.391) / -0.12 (0.160) / -0.07 (0.391)
Abbreviations: Chr, Chromosome; ns, non significant
a Location and LOD score of the significant eQTL. Sex was added as a covariate in the eQTL analysis for Male+Female.
b Fold change and p-value between MRL compared to SM in males and females separately in the F2 mice.
c The correlation was calculated over the entire population (males and females), female only or male only after adjusting the rank Z transformed phenotype for sex.
9