SUPPLEMENTAL MATERIAL
Supplemental Methods
Social Defeat Stress
Before the first defeat, all rats in the stress group were exposed overnight to an empty clean chamber with all portholes open, allowing free access to all zones so that they become familiar with the apparatus. Male “resident” rats (500-800g) with a previous history of aggression towards smaller male intruders were then pair-housed with females in the fight zone of the compartment for the duration of the experiment. Latencies to move from the home cage to the threat zone, from the fight zone to the threat zone, and from the threat zone back to home cage were recorded. In addition, the resident and intruder were video recorded during each defeat, and salient behavioral elements subsequently analyzed to assess coping styles: frequency and duration of walking, rearing, escape, defensive upright posture, submissive posture, and attack bites received. A trained observer analyzed each video recording using a custom keyboard and commercial software (The Observer Video-Pro© version 9.0, Noldus Information Technology, Wageningen, The Netherlands).
Saccharin drinking and open field testing
Rats were randomly assigned to stressed (n=39) or control (n=43) groups and were tested for 0.02% saccharin preference in a weekly one-hour two bottle choice procedure. To avoid taste novelty, all rats were allowed to freely drink saccharin the night prior to baseline measurements. Five baseline saccharin measurements were obtained one week prior to social defeat stress/control handling, and the average of the five sessions determined each rat’s baseline preference score. Saccharin preference was calculated as the ratio of saccharin consumed to overall fluid consumption (saccharin + water). Saccharin preference sessions were performed weekly throughout the stress period and one week after stress termination. Rats were also tested weekly for locomotor activity in an open field. Rats were removed from their homecage during the dark phase and placed in the center of a large open field (71x45x45cm). After 30 min habituation, a novel object was placed into the arena and one 5-min video sample was recorded for novel object exploration. Total distance traveled throughout the habituation and novel object exploration was measured by Ethovision. Baseline measurements were performed 1 week prior to the social stress phase. Further testing occurred once per week throughout the stress period and one week after stress exposure.
Locomotor cross-sensitization to cocaine
Ten days after the final social defeat episode (day 31), rats were tested for cross-sensitization to acute cocaine challenge as previously described (Boyson et al. 2014; Covington and Miczek 2001, See Supplemental Material). Each rat was transported to an adjacent room, injected with saline (i.p.), and returned to its homecage. Five minutes following the saline injection, rats were videotaped for five minutes (minutes 5-10 post injection). Rats were then injected with cocaine (10 mg/kg, i.p.) and five minutes post-injection video recorded for five minutes (minutes 5-10 post injection). A trained observer analyzed each video recording for frequency and duration of walking behavior using a custom keyboard and commercial software (The Observer Video-Pro©).
Intravenous cocaine self-administration
IV catheter surgery. Rats were permanently implanted with an indwelling catheter (Silastic® silicon tubing, ID 0.63mm, OD 1.17mm) into the right jugular vein under ketamine (100 mg/kg) and xylazine (6 mg/kg) anesthesia. The catheter was passed subcutaneously through the back where it exited through a small incision between the scapulae and was attached to a pedestal mounted inside a harness (SAI Infusion Technologies, Lake Villa, IL). Rats were allowed to recover for at least 5d, then were moved from their home cage to permanent housing inside cocaine self-administration chambers. Rats were housed in custom-built acrylic cages (30 x 20.5 x 24.5 cm) lined with Cellu-Dri pellet bedding. Each cage had a removable panel on one wall which contained one cue light, one session light, and two retractable levers. To ensure catheter patency, catheters were flushed daily with 0.2 ml saline and 0.2 ml heparinized saline (20 IU/ml), and 0.17 ml pulses of saline delivered every 30 minutes except during the daily self-administration session.
Acquisition/Maintenance. Rats were initially allowed to self-administer cocaine (0.75 mg/kg/infusion, administered 0.15 ml/kg at 0.018 ml/s) without priming or autoshaping on a fixed ratio 1 (FR1) schedule of reinforcement, followed by a 30 s timeout. Each daily session terminated after 15 infusions or 5 h. Once animals demonstrated reliable, stable responding at FR1, operationally defined as two consecutive days of maximal responding (15 infusions), the schedule was gradually advanced to FR5 to ensure rats were reliably performing for cocaine and infusions were not the result of accidental or unintentional lever responding. Rats were maintained on a limited access FR5 schedule for at least 5 consecutive days.
Progressive Ratio. Rats were then subjected to a progressive ratio (PR) schedule, with the following response increment: 1, 2, 4, 6, 9, 12, 15, 20, 25, 32, 40, 50, 62, 77, 95, 118, 145, 178. Sessions terminated after 60 min without reinforcement. Three PR sessions (0.3 mg/kg/infusion) were alternated with three FR5 maintenance sessions (0.75 mg/kg/infusion) across six days, and the median breakpoint of the three PR sessions was used as the dependent variable for analysis.
Twenty-four hour “binge”. The day after the final FR5 maintenance session, rats were given unlimited access to cocaine (FR5, 0.3 mg/kg/infusion) for 24 hours. On completion of the “binge”, catheter patency was verified by propofol infusion.
Go/No-Go Task
To avoid taste novelty, after the last day of social defeat (or control), rats were exposed to a bottle with 0.02% saccharin overnight. Throughout testing, rats were water restricted for approximately 16 h Sunday through Thursday.
Each session of the Go/No-Go task ended after 60 trials. An operant conditioning panel containing two nosepoke ports equipped for fluid delivery, a house light, and two cue lights above each nosepoke port was inserted into each rat’s home cage, which was placed inside a sound-attenuating chamber. For each trial of the Go/No-Go task, there was a variable precue period (9-24 s), signaled by the house light, and responses were recorded but not reinforced. The variable precue period prevented the animal from predicting when the cue would begin. During the initial training phase, the precue period was followed by a 30-s “Go” cue (constant light above the Go hole). When the Go cue was displayed, the first nosepoke response resulted in the delivery of 0.07 ml 0.02% saccharin. After rats successfully completed >30 trials within 1 h for 4 consecutive sessions, the cue duration was reduced from 30 to 10 s. After completion of >30 trials within 1 h for 4 consecutive sessions at 10 s, the cue light was reduced to 5 s.
After stable responding was again demonstrated, the “No-Go” cue (flashing cue light of a different color above the opposite nosepoke) was introduced on 5 consecutive sessions. When the No-Go cue was presented, rats must inhibit nosepoke responding for reinforcement at the termination of the cue. A nosepoke response (false alarm) terminated the trial and no saccharin was delivered. Go and No-Go trials were randomly ordered, with Go trials occurring 75% of the time. After either trial type, a 10 s intertrial period occurred with all lights off and no reward available.
BDNF and TrkB mRNA quantification
The hippocampus and PFC were quickly dissected and placed in TriReagent (Molecular Research Center, Inc). Tissue was treated with DNAse (2U TURBO DNAse, Ambion) and tested for genomic DNA contamination in PCRs. Quantity and integrity of mRNA was validated with a NanoDrop spectrophotometer (ThermoScientific). cDNA was synthesized using 1.5 μg total RNA, 200 units of Superscript II reverse transcriptase (Invitrogen) and 1 μl random hexamers (Invitrogen) in a 20 μl reaction. qRT-PCR amplification was performed with a MX-30000P Stratagene cycler with SYBR green PCR master mix (Applied Biosystems) and a two-step protocol: 95°C for 10 min, followed by 45 cycles with 95°C for 30 s, 55°C for 30 s, and 72°C for 30 s. Relative levels of each mRNA sample were analyzed using the comparative Ct method (Schmittgen and Livak 2008). The specific primer sequences used were as follows: ß-actin forward: GGCTGTATTCCCCTCCATCG, ß-Actin reverse: CCAGTTGGTAACAATGCCATGT (Cordeira et al. 2010). BDNF forward: TTAGCGAGTGGGTCACAGCG, BDNF reverse: ATTGGGTAGTTCGGCATTGC (Huang et al. 2010), TrkB forward: CCTCCACGGATGTTGCTGAC, TrkB reverse: GCAACATCACCAGCAGGCA (Cordeira et al. 2010).
CRF measurement
Brains were immediately frozen in isopentane over dry ice and stored at -80°C until analysis. Bilateral micropunches (1 mm diameter) of the nucleus accumbens (NAc), amygdala, and ventral tegmental area (VTA) were taken in a -20°C cryostat and immediately placed in Protein LoBind Eppendorf tubes over dry ice. All samples were weighed to obtain net weight of tissue for proper dilution. After obtaining all tissue samples, a 30-fold dilution (10mM {BS + 0.2% NP-40) and a homogenizer were used to lyse cells. Samples were centrifuged for 20 min at 4°C and supernatant transferred to a new Protein LoBind centrifuge tube, and EIA performed according to the provided protocol. Total protein was determined using the Bradford protein assay. All samples fell inside the standard curve range (CRF: 0.2-25 ng/ml; protein: 0.1-1.4 mg/ml).
Supplemental Results
Individual differences in latency to enter threat zone did not affect other defeat behavior
The “fast” rats had significantly lower latencies to enter the threat zone compared to the “slow” rats (Student’s t=14.328, df=24, p<0.001), however, these groups did not differ in fight duration, latency to escape the fight, or latency to return to the safe zone. Furthermore, there were no significant differences between “fast” and “slow” rats on specific behaviors before, during, or after the fight period.
Pre- and post- fight behavior. Behavior changed after the fight period regardless of group (data not shown). Two-way repeated measures ANOVA revealed significant main effects of time spent immobile after the fight (F1,24=11.445, p=0.002), associated with a significant decrease in walking duration (F1,24=95.826, p<0.001), sniffing (F1,24=5.300, p=0.030), and naso-naso contact with the resident (F1,24=5.622, p=0.026).
Fight behavior. A lag 1 sequential analysis was performed to asses differences in behaviors immediately following an attack bite (i.e percentage of supine position following an attack bite) to evaluate whether “fast” and “slow” rats engaged in different coping styles during the confrontation. There was no significant difference in the proportion of attack bites that were followed by supine posture vs those followed by defensive posture between the “fast” and “slow” rats (data not shown). Additionally, there were no differences between “fast” and “slow” rats in specific behaviors measured during the social defeat (Supplemental Table 1).
Supplemental Table 1. Frequency and duration of behaviors in “slow” (bottom 33%, n=13) and “fast” (top 33%, n=13) rats during social defeat stress. All values are means ± SEM.
“Slow” / “Fast”Walking / Frequency / 13.6±6.36 / 13.5±5.09
Duration / 25.82±15.52 / 32.15±15.76
Rearing / Frequency / 4.2±1.68 / 2.1±2.07
Duration / 15.59±6.16 / 9.672±6.89
Escape / Frequency / 2.5±1.00 / 2.1±0.48
Duration / 1.266±0.95 / 2.531±0.74
Defensive Upright / Frequency / 6±2.62 / 9.4±2.57
Duration / 21.79±10.79 / 22.76±2.57
Supine / Frequency / 2.6±0.734 / 3.5±0.62
Duration / 13.77±4.49 / 16.67±2.43
Attack bites received / 6.4±0.97 / 7.0±1.21