Detection of IDH1/2 Mutations and Loss of Heterozygosity (LOH) Analysis in Glioma Tissues

Supplementary Methods

Detection of IDH1/2 mutations and loss of heterozygosity (LOH) analysis in glioma tissues

To screen for IDH1andIDH2 mutations, direct sequencing was performed to detect mutation hotspots. Each sequencing reaction was performed using the BigDye Terminator v1.1 Sequencing kit (Applied Biosystems, Carlsbad, CA, USA), followed by purification of the sequencing products using Sephadex G50 gel filtration (GE Healthcare, Fairfield, CT, USA). Capillary electrophoresis was performed on an ABI 3100 Genetic Analyzer (Applied Biosystems). Raw data were analyzed using the phred/phrap/consed package ( for sequence determination. As described previously, the primers for IDH1 and IDH2 were as follows: IDH1f, CGGTCTTCAGAGAAGCCATT; IDH1r, GCAAAATCACATTATTGCCAAC; IDH2f, AGCCCATCATCTGCAAAAAC; and IDH2r, CTAGGCGAGGAGCTCCAGT (1).

LOH on chromosomes 1p, 10, 17p or 19q was evaluated using a previously described polymerase chain reaction-based microsatellite analysis (2). Multiple polymorphic microsatellite markers were used to perform extensive analysis of these chromosomal regions. We used 24 markers in this analysis: D1S2667, D1S2647, D1S2734, D1S2797, D1S2766, D1S435, and D1S206 were used for 1p; D10S249, D10S189, D10S1649, and D10S213 for 10p; D10S1652, D10S537, D10S1765, D10S185, D10S587, and D10S216 for 10q; D17S831, D17S1876, and D17S1791 for 17p; and D19S420, D19S219, D19S921, and D19S412 for 19q. LOH was defined when at least 2consecutive markers showed an allelic imbalance as reported previously (2).

Supplementary References

1. Hartmann C, Meyer J, Balss J et al. (2009) Type and frequency of IDH1 and IDH2 mutations are related to astrocytic and oligodendroglial differentiation and age: a study of 1,010 diffuse gliomas. Acta Neuropathol118:469-474.doi: 10.1007/s00401-009-0561-9
2. Yoshimoto K, Iwaki T, Inamura T, Fukui M, Tahira T, Hayashi K (2002) Multiplexed analysis of post-PCR fluorescence-labeled microsatellite alleles and statistical evaluation of their imbalance in brain tumors. Jpn J Cancer Res 93:284-290.

Supplementary figure legends

Supplementary Figure 1

Summary of 7 cases for whichmultiple tumor specimens from different regions within the same tumor were obtained

Of 14 samples obtained from seven patients, 1p LOH was not detected in anysample. 10 LOH was detected in 10samples. 17p LOH was detected in 6samples. 19q LOH was detected in 6samples. In 6 cases, intratumoral heterogeneity in DNA level was detected, and intratumoral heterogeneity in RNA level was detected in the remaining case.

Supplementary Figure 2

Statistical correlation of the PN score with the expression of histone-modifying genes

Supplementary Figure 3

Statistical correlation of the MES score with the expression of histone-modifying genes

Supplementary Table 1

List of primer sequences used in this study

Supplementary Table 2

Case summary and relative quantitative values of gene expressionin this study

Supplementary Table 3

Relative quantitative values of histone-modifying gene expression in this study