Synthesis Proposal for RBS Measurement Plasmid
Motivation for synthesis:
Due to difficulties encountered in trying to assemble I2055 (944bp), a device to measure RBS effectiveness, we propose to synthesize it instead. The steps still remaining to build it by hand include: (1) Assembly of R0040 and I13401, (2) scarring the existing BB sites by PCRing the assembled device with Mfe and Nsi, and (3) Re-inserting a BB site via PCR. We’ve had no success at step (1) either via standard assembly or by adding the promoter with a tail during PCR, furthermore step (3) has not yet been successfully achieved on other constructs (Promoter tester) that have made it through (1) and (2), so it may be challenging as well. The relatively small size (944bp) of the construct suggests that synthesizing it with Mfe and Nsi at the end and following with a single cloning step would likely save both time and money in this case.
Design specification of the construct:
To better simulate construction conditions, the device will not have a full BioBricks site. It will be made in two versions. One will have an EcoRI-XbaI site, and the other will have an SpeI-XbaI site. The E-X version is easier to use, but leaves a larger space between the promoter and RBS than would occur in BioBricks construction. Inserting an RBS into the S-X site perfectly replicates a BioBricks assembly, but is more difficult for the user because the RBS must be inserted in the proper direction.
v1
v2
Since synthesis of both versions would be expensive, we will only request the E-X version for synthesis. It turns out that the last 6 base pairs of R0040 are a restriction site (BsiHKAI) that is unique in I2055. This allows us to create a short oligo with BsiHKAI, SpeI, and XbaI sites (in that order), and replace the EcoRI site on I2055 with a SpeI site via a simple digest and ligation. The synthesized device will have an MfeI site on the 5’ end and an NsiI site on the 3’ end. MfeI and NsiI are complementary to EcoRI and PstI sticky ends, respectively, so the device can be ligated into a backbone plasmid without leaving a BioBricks site.
Construct to convert v1 into v2 without requiring another synthesis order.
Sequence specification of the construct:
MfeIR0040 [BsiHKAI in bold] Spacer EcoINotISpacer XbaIE0040 BB Mixed siteB0015 NsiI
CAATTGTCCCTATCAGTGATAGAGATTGACATCCCTATCAGTGATAGAGATACTGAGCACTGAATTCGCGGCCGCTTCTAGATGCGTAAAGGAGAAGAACTTTTCACTGGAGTTGTCCCAATTCTTGTTGAATTAGATGGTGATGTTAATGGGCACAAATTTTCTGTCAGTGGAGAGGGTGAAGGTGATGCAACATACGGAAAACTTACCCTTAAATTTATTTGCACTACTGGAAAACTACCTGTTCCATGGCCAACACTTGTCACTACTTTCGGTTATGGTGTTCAATGCTTTGCGAGATACCCAGATCATATGAAACAGCATGACTTTTTCAAGAGTGCCATGCCCGAAGGTTATGTACAGGAAAGAACTATATTTTTCAAAGATGACGGGAACTACAAGACACGTGCTGAAGTCAAGTTTGAAGGTGATACCCTTGTTAATAGAATCGAGTTAAAAGGTATTGATTTTAAAGAAGATGGAAACATTCTTGGACACAAATTGGAATACAACTATAACTCACACAATGTATACATCATGGCAGACAAACAAAAGAATGGAATCAAAGTTAACTTCAAAATTAGACACAACATTGAAGATGGAAGCGTTCAACTAGCAGACCATTATCAACAAAATACTCCAATTGGCGATGGCCCTGTCCTTTTACCAGACAACCATTACCTGTCCACACAATCTGCCCTTTCGAAAGATCCCAACGAAAAGAGAGACCACATGGTCCTTCTTGAGTTTGTAACAGCTGCTGGGATTACACATGGCATGGATGAACTATACAAATAATAATACTAGAGCCAGGCATCAAATAAAACGAAAGGCTCAGTCGAAAGACTGGGCCTTTCGTTTTATCTGTTGTTTGTCGGTGAACGCTCTCTACTAGAGTCACACTGGCTCACCTTCGGGTGGGCCTTTCTGCGTTTATAATGCAT
Total size: 944bp.
Sequence specification of the conversion construct:
BsiHKAI Spacer SpeI NotISpacer XbaI
GAGCACTACTAGTGCGGCCGCTTCTAGA
(this will be ordered as an oligo).