Expanded materials & methods
EXPANDED MATERIALS and METHODS
Peptides, reagents and solvents were purchased from sources described before1-3. Ang 1-9 was synthesized by the Protein Sciences Facility of the University of Illinois, Champaign-Urbana. Dansyl-Phe-Leu-Arg was synthesized4 and cell cultures were done as previously reported 1-3,5,6 with CHO/AB cells that were transfected to express both human ACE and human B2 receptor or human pulmonary arterial endothelial cells that express both constitutively.
Preparation of Tissues
Human heart tissue samples were obtained from 16 patients who underwent surgical procedures over a two-year period (1998-2000). Their mean age was 62 years (range 39-84 years). Atrial tissue was obtained from the right atrial appendage of 12 patients (9 men and 3 women) who had coronary bypass graft operations (n=10) or valve replacement (aortic and mitral valves, 1 each). Two of the 12 patients were on ACE inhibitors. Left ventricular tissue specimens were obtained from the explanted native heart of one patient (59 year old man) who underwent heart transplantation for an ischemic cardiomyopathy and from three donor hearts obtained of three male patients whose hearts were not used for transplantation. Only the former patient was on an ACE inhibitor.
Heart specimens from the surgical procedures were collected and immediately transported to the laboratory for processing. Donor heart specimens were placed into saline solution at 4°C. Samples obtained during surgical procedures with the permission of the Institutional Review Board of the University of Illinois-Chicago, were stored at –70°C. Samples were homogenized in 200 mmol/L sodium acetate at pH 5.5. The preparations were centrifuged at 16,000 x g for 10 min at 4°C. The collected supernatant constituted preparation 1 (Prep 1). The pellets from the preparation in sodium acetate buffer were raised with sonication at 4°C. The raised pellet preparation was then brought to 1% of Chaps, incubated at 4°C for 1 h with mixing, then centrifuged at 1000 x g for 10 min. The resulting supernatant constituted preparation 2 (Prep 2).
Enzyme Assays
In routine assays, 100 mmol/L Ang I was the substrate. The buffer at pH 5.5 was 200 mmol/L sodium acetate or at pH 7.0, 200 mmol/L sodium phosphate. After 60 min incubation at 37°C, the reactions were stopped with 5% trifluoroacetic acid, the tubes were centrifuged at 16,000 x g for 10 min and the supernatant was used in the HPLC assay7,8.
Deamidation by Human Heart Tissue
The substrate was 300 mM D-Ala2-Leu-enkephalinamide and 25 mL of human atrial tissue preparation the enzyme source. Assays were done at 25°C7.
Immunoprecipitation
Aliquots of the 16,000 x g human atrial or ventricular preparations (Prep 1) were immunoprecipitated. The antiserum was elicited in rabbits using a truncated recombinant CATA as antigen9. The final dilution of the antiserum in the reaction mixture was 1:100 v/v. After incubation, the reaction mixtures were treated with insoluble (S. aureus) protein A and, after centrifugation at 16,000 x g for 10 min, the supernatant was collected for enzymatic assay with Ang I at pH 5.5.
Potentiation of Arachidonic Acid Release from Cultured Cells
These experiments were done as described1-3 with 3H arachidonic acid (AA) loaded cultured cells in 6-well plates. The receptor agonists2 (BKan) and/or other agents were then added to cells in the wells. Wells of cells treated with just medium served as background controls. The release of [3H]AA to the medium after agonist addition was measured by liquid scintillation counting.
Recombinant CATA Expression
A cDNA coding for the human CATA was isolated from a Lambda gt 10 human kidney cDNA library, kindly donated by Dr. G. Bell of the University of Chicago, using a 700 bp PCR fragment as the probe. However, in this clone, the 5¢ end sequence upstream from the second base (T) of the translation initiation codon was missing. Two oligonucleotide primers (5¢GAAGATCTGGAGATGATCCGAGCCGCGCCGCCG and
DAC1 5¢CACAAACCAGTAGTGGAGGTGCTT) were used in a PCR reaction to introduce a complete ATG and a Bgl II cloning site. The PCR products were digested with Bgl II and Sma I and the 120 bp Bgl II-Sma I fragment was ligated with 1.6 kb Sma I-ECO RI fragment of the CATA cDNA into the Bgl II-Eco RI sites of the baculovirus expression vector pVL 1392 and designated DA-pVL1392.
The DNA of the expression vector DA-pVL1392 was co-transfected into High Five cells (Invitrogen) with linearized BaculoGold baculovirus DNA in a ratio of 5:1, using lipofectin reagent. The recombinant virus expressing human CATA was isolated, amplified, and used to infect High Five cells cultured in 150 mm dishes. Recombinant CATA was obtained as briefly described before as deamidase9.
A day after the High Five insect cells were infected with recombinant virus, the enzymatic activity, measured with Dansyl-Phe-Leu-Arg4 in culturing medium, started to increase, reaching its peak in 3-4 days. One liter of the expression medium was collected 4 days after infection, centrifuged and subjected to ammonium sulfate precipitation. The precipitate derived after 40% to 60% of saturation contained the most activity and was collected by centrifugation. The pellet was washed with 60% ammonium sulfate, redissolved in 100 ml of 50 mM sodium acetate (pH 5.5), and dialyzed against this buffer overnight at 4°C. After centrifugation, the single chain CATA is treated with trypsin10. The activated CATA was purified on a S-Sepharose column equilibrated with 50 mM sodium acetate, pH 5.5, and eluted with a linear sodium chloride gradient from 0 to 0.5 M over 40-fold column volume.
Truncated CATA Expression
Total RNA was isolated from human platelets by using a kit from Clontech. First strand cDNA was reverse transcribed from the platelet RNA using a cDNA synthesis kit (Clontech).
A 947 bp cDNA fragment of human protective protein (from bp 144 to 1091) was amplified from human platelet cDNA through polymerase chain reaction using as primers: 5'GGAATTCCGCCAGTACTCCGGCTACCTC3', and 5'GGAATTCACATGTCCCATTGTGGCAGC3'. This fragment was subsequently cloned into pGEM 7Z(-) vector and sequenced.
The fragment was cloned into the (His) TAG expression vector pRSET Eco RI site (Invitrogen) and the direction of the insert was verified by Bam HI digestion. The reading frame was confirmed by DNA sequencing and named DE-RSET. The BL21(DE3) cells carrying expression plasmid DE-RSET were grown in LB medium containing 0.2 mg/ml ampicillin to the log phase. Then, isopropyl β-D-thiogalactopyranoside was added to the medium to the final concentration of 1 mM to induce the expression. The cells were pelleted and extracted with 6 M guanidine hydrochloride with sonication and centrifugation.
The supernatant was collected, diluted 1:10 with 8 mol/L urea in 0.2 mol/L sodium phosphate and 0.5 mol/L sodium chloride at pH 8, and applied to an iminodiacetic -Sepharose 4B column, saturated with NiCl2 (5 mg/ml) and then equilibrated with the same buffer. The recombinant protein was released from the column by the denaturing elution as above but with 20 mmol/L sodium phosphate at pH 4.
The mature form of CATA is composed of two peptide chains connected by disulfide bonds10. The protein sequence for which the cDNA fragment codes spans from N-terminal residue 19 of the 34 kDa native peptide to N-terminal residue 29 of the 20 kDa peptide, which includes the active center Ser residue and the cleavage site of the two chains. This form of rCATA (100 mg) was used to immunize New Zealand rabbits.
Immunohistochemistry
Formalin fixed, paraffin-embedded tissue blocks from two male heart atria were selected at random from the Surgical Pathology files at the University of Illinois Hospital. All tissues had been obtained at surgery within 8 months and were initially reviewed. Four micron sections were cut. With the permission of the Institutional Review Board, human kidney biopsy sections were used as positive control for CATA.
IgG fraction of the antiserum to CATA was used to detect CATA in tissue sections. Biotinylated goat anti-rabbit antibody was then applied for 1 h. Next, the sections were covered with streptavidin peroxidase complex. Subsequently they were washed and incubated with diaminobenzidine substrate for 5 min (for brown stain) or 3-amino-9-ethicarbazole (for red stain). Then the slides were counterstained with hematoxilin.
NO Technique
The NO release was monitored with a porphyrinic microsensor of five to seven carbon fibers of diameter 0.2 mm, which are electroplated with highly conductive polymeric porphyrin. This microsensor is supercoated with negatively charged polymer (Nafion) so that negatively charged molecules such as nitrite or nitrate cannot gain access to the porphyrinic surface and therefore do not interfere with NO measurements. This microsensor is highly sensitive for NO (10-9 mol/L detection limit) with rapid response time in 104 seconds. Cells were plated confluently in 12-well plates and the responses, current v. time, were recorded continuously. The current generated on the porphyrinic electrode was proportional to the NO released. A computer based potentiostat was used to monitor NO concentration with time11.
Statistics
Means and S.E. were calculated for the experiments and statistical significance of differences between means was tested by one-way analysis of variance. Concerning NO release, the experimental values were tested using the Kolmogorov and Smirnov one way ANOVA test for significant differences between groups (Instat software application). Very significant differences were found between groups. Significant differences between individual experimental groups were tested for using the Tukey-Kramer multiple comparison test (Instat). A number of comparisons between experimental groups were significantly to very significantly different. The dose-response curve for NO release potentiation was redrawn also as a sigmoidal curve fitting the data according to Boltzman.
REFERENCES to Expanded Materials and Methods
1. Minshall RD, Tan F, Nakamura F, Rabito SF, Becker RP, Marcic B, Erdös EG. Potentiation of the actions of bradykinin by angiotensin I converting enzyme (ACE) inhibitors. The role of expressed human bradykinin B2 receptors and ACE in CHO cells. Circul. Res. 1997;81:848-856.
2. Marcic B, Deddish PA, Skidgel RA, Erdös EG, Minshall RD, Tan F. Replacement of the transmembrane anchor in angiotensin I-converting enzyme (ACE) with a glycosylphosphatidylinositol tail affects activation of the B2 bradykinin receptor by ACE inhibitors. J Biol Chem. 2000;275:16110-8.
3. Marcic BM, Erdös EG. Protein kinase C and phosphatase inhibitors block the ability of angiotensin I-converting enzyme inhibitors to resensitize the receptor to bradykinin without altering the primary effects of bradykinin. J Pharmacol Exp Ther. 2000;294:605-12.
4. Jackman HL, Tan F, Schraufnagel D, Dragovic T, Dezsö B, Becker RP, Erdös EG. Plasma membrane-bound and lysosomal peptidases in human alveolar macrophages. Am. J. Respir. Cell Mol. Biol. 1995;13:196-204.
5. Deddish PA, Marcic B, Jackman HL, Wang H-Z, Skidgel RA, Erdös EG. N-domain specific substrates and C-domain inhibitors of angiotensin converting enzyme: Angiotensin-(1-7) and keto-ACE. Hypertension. 1998;31:912-917.
6. Marcic B, Deddish PA, Jackman HL, Erdös EG. Enhancement of bradykinin and resensitization of its B2 receptor. Hypertension. 1999;33:835-843.
7. Jackman HL, Tan F, Tamei H, Beurling-Harbury C, Li X-Y, Skidgel RA, Erdös EG. A peptidase in human platelets that deamidates tachykinins: Probable identity with the lysosomal "protective protein.". J. Biol. Chem. 1990;265:11265-11272.
8. Jackman HL, Morris PW, Deddish PA, Skidgel RA, Erdös EG. Inactivation of endothelin I by deamidase (lysosomal protective protein). J. Biol. Chem. 1992;267:2872-2875.
9. Tan F, Jackman HL, Harbury P, Deddish PA, Becker RP, Abe M, Skidgel RA, Erdös EG. Identity of human platelet deamidase with lysosomal protective protein (LPP). FASEB J. 1994;8:A1372 (Abstract).
10. Bonten EJ, Galjart NJ, Willemsen R, Usmany M, Vlak JM, d'Azzo A. Lysosomal protective protein/cathepsin A. Role of the "linker" domain in catalytic activation. J Biol Chem. 1995;270:26441-5.
11. Pinsky DJ, Patton S, Mesaros S, Brovkovych V, Kubaszewski E, Grunfeld S, Malinski T. Mechanical transduction of nitric oxide synthesis in the beating heart. Circ Res. 1997;81:372-9.
8