1645/R2-3

ONLINE SUPPLEMENT

Protein analysis

For immunoblotting, cells were lysed in 50 mmol/L Tris/HCl, pH 7.4, 250 mmol/L NaCl, 0.5% NP-40, 10% glycerol, 5 mmol/L EDTA, 50 mmol/L NaF, 0.5 mmol/L Na3VO4, 10 mmol/L b-glycerophosphate, PMSF, 5 µg/ml leupeptin and aprotinin. Lysates were separated on 10% or 15% SDS-PAGE, proteins transferred to Immobilon membranes (Millipore), and immunoblotted with specific antibodies. Immunoblots were visualized by enhanced chemiluminescence (Amersham).

Generation of xIAP mutants, GST-fusion proteins and in vitro cleavage

The complete coding sequence of xIAP was amplified by PCR from a pcDNA3-human hILP expression vector using the forward primer 5’-GGGAATTCATGACTTTTAACAGTTTTGAAGGAT-3’ and the reverse primer 5’-CTCTCGAGCATGCCTACTATAGAGTTAGA-3’. The two xIAP truncation mutants T1-xIAP and T2-xIAP were generated using the same approach by introducing a STOP-codon into the primer at position 243 of the protein (5’-CTCTCGAGCTAATCAGATTCACTTCGAATATTAAG-3’) or an ATG codon at position 242 (5’-GGGAATTCATGGCTGTGAGTTCTGATAGGAATTTC-3’), respectively. The PCR products were cloned into the EcoRI-XhoI sites of pcDNA3.1 (Invitrogen) and pGEX-4T-1 (Pharmacia), respectively. The uncleavable mutant of xIAP was generated by site-directed mutagenesis: the sequence 239SESD242 was converted to 239SESE242 using the QuikChange Site-Directed Mutagenesis Kit from Stratagene and the primers 5’-CGAAGTGAATCTGAGGCTGTGAGTTCTGATAGG-3’ and 5’-CCTATCAGAACTCACAGCCTCAGATTCACTTCG-3’.

Transfection and luciferase reporter assay

Cells (0.3 x 106 in 60 mm dishes) were transfected with 11 µg of DNA and lipid Pfx-7 (Invitrogen) for 4 hours in Optimem (Gibco BRL). For cotransfection experiments, the indicated amounts of each plasmid were used for a total of 11µg of DNA per 60 mm dish. Cells were grown for 36 hours in full medium and lysed, and luciferase activity was measured using a luciferase assay system (Promega) according to the manufacturer’s instructions. NF-kB-independent transcription (background) was determined by transfecting a non-kB-dependent luciferase reporter construct (pfLUC) in parallel as previously described.1

Electrophoretic mobility-shift assays

A double-stranded oligonucleotide containing the DNA-binding site for the NF-kB proteins (5'AGTTGAGGGGACTTTCCCAGGC3') was end-labeled using [g32P]ATP according to the manufacturer's protocol (Promega). Nuclear extracts were obtained by a modified Dignam protocol.2 Cells were trypsinized, washed with PBS, and resuspended in 200 µl of buffer A (10 mmol/L Hepes, pH 7.9, 10 mmol/L KCl, 1.5 mmol/L MgCl2, 0.1% NP-40, 1 mmol/L PMSF, 0.5 mmol/L DTT, 10 µg/ml aprotinin, leupeptin, and pepstatin A) and allowed to swell on ice for 20 minutes. The nuclei were separated by centrifugation at 12,000 g for 5 min at 4° C in a microfuge. The nuclear pellet was resuspended in 20 µl of buffer C (20 mmol/L Hepes, pH 7.9, 420 mmol/L NaCl, 1.5 mmol/L MgCl2, 0.2 mmol/L EDTA, pH 8.0, 25% Glycerol, 1 mmol/L PMSF, 0.5 mmol/L DTT, 10 µg/ml aprotinin, leupeptin, and pepstatin A) and incubated for 20 minutes on ice. The lysed nuclei were centrifuged for 5 min at 4°C in a microfuge. The nuclear extracts were assayed for protein content using the Biorad BCA assay method. The binding reaction was carried out at room temperature for 15 minutes, mixing 10 µg of nuclear extracts with 50,000 cpm of labeled probe, 4µl of 5x binding buffer (50 mmol/L Tris, pH 7.5, 0.25 mol/L NaCl, 5 mmol/L DTT, 5 mmol/L EDTA pH 8.0, Ficoll Powder 1.5% w/v) and 4 µg of Poly dIdC.dIdC. The samples were run on a 5% non-denaturing acrylamide gel. For supershift EMSA, the samples were incubated with 6 µl of control or NF-kB antibodies (Santa Cruz Biotechnology) for 45 minutes before running. The gels were dried and bands detected by autoradiography.

REFERENCES

1. Levkau B, Scatena M, Giachelli CM, Ross R, Raines EW. Apoptosis overrides survival signals through a caspase-mediated dominant-negative NF-kB loop. Nat Cell Biol. 1999;1:227-233.

2. Guo X, Zhang YP, Mitchell DA, Denhardt DT, Chambers AF. Identification of a ras-activated enhancer in the mouse osteopontin promoter and its interaction with a putative ETS-related transcription factor whose activity correlates with the metastatic potential of the cell. Mol Cell Biol. 1995;15:476-487.

3