1
SOM.Table 1 Primers used for amplification of virus genomic components in yellow vein mosaic disease of Croton bonplandianum
Primer / Sequence (5' to 3') / Binding sites in the genome / Expected size (kb) / Annealing temp (°C) / For amplification ofzAV26fx / gcccacatygtcttyccngt / 1924-1944 / 1.2 / 42 / Part of the Rep, full IR, AV2 and part of AV1
AV27rx / ggcttyctrtacatrgg / 463-446
Cy1f / atttcagtaattagggccaga / 280-301 / 1.8 / 52 / End of AV2 to end of Rep
Cy2r / ttacacctccaatggaggtt / 2099-2080
AV59f / gtgggatccattagtaaacgagt / 150-168 / 2.7 / 58 / Full length CYVMV DNA-A
AV60r / aatggatcccacatagtgcg / 158-142
Beta 01y / ggtaccactacgctacgcagcagcc / 1286-1305 / 1.3 / 55 / Full length betasatellite
Beta 02 y / ggtacctaccctcccaggggtacac / 1280-1261
BM90f / atgtcgaagcgtccagcagat / 305-326 / 0.70 / 48 / Coat protein gene of CYVMV
BM82r / tacagaatcgtagaagtaa / 1067-1048
AV30F / ttggatccatggcgaagcgacca / 281-296 / 0.77 / 48 / Coat protein gene of ToLCNDV
AV31R / aagagctcttaatttgtgaccga / 1052-1037
x Modified from Rojas et al., 1993 [30]
y Briddon et al., 2002 [2], bold indicates restriction sites.
zCYVMV: croton yellow vein mosaic virus, ToLCNDV: tomato leaf curl New Delhi virus
1
Plant speciesx / Infected/Inoculatedy / Days to symptoms / Symptoms
Cultivated plants
Abelmoschus esculentus / 0/50 / 0 / No symptom
Arachis hypogaea / 0/25 / 0 / No symptom
Capsicum annuum / 0/20 / 0 / No symptom
Cucumis sativus / 0/20 / 0 / No symptom
Crotalaria juncea / 0/25 / 0 / No symptom
Cajanus cajan / 0/25 / 0 / No symptom
Daucus carota / 0/24 / 0 / No symptom
Eleusine coracana / 0/20 / 0 / No symptom
Helianthus annuus / 0/20 / 0 / No symptom
Gossypium hirsutum / 0/30 / 0 / No symptom
Lagenaria vulgaris / 0/20 / 0 / No symptom
Lablab purpureus / 0/20 / 0 / No symptom
Luffa accutangula / 0/25 / 0 / No symptom
Macrotyloma uniflorum / 0/20 / 0 / No symptom
Manihot esculenta / 0/25 / 0 / No symptom
Oryza sativa / 0/20 / 0 / No symptom
Phaseolus lunatus / 0/20 / 0 / No symptom
Sesamum indicum / 0/30 / 0 / No symptom
Vigna mungo / 0/20 / 0 / No symptom
Vigna radiata / 0/20 / 0 / No symptom
Vigna unguiculata / 0/20 / 0 / No symptom
Ornamental plants
Callistephus chinensis / 0/25 / 0 / No symptom
Catharanthus rosesus / 0/20 / 0 / No symptom
Celosia argentea / 0/20 / 0 / No symptom
Gomphrena globosa / 0/20 / 0 / No symptom
Mirabilis jalapa / 0/20 / 0 / No symptom
Salvia splendens / 0/25 / 0 / No symptom
Tagetes erecta / 0/20 / 0 / No symptom
Weeds
Acalypha indica / 0/40 / 0 / No symptom
Amaranthus viridis / 0/30 / 0 / No symptom
Bidens pilosa / 0/25 / 0 / No symptom
Datura metel / 0/20 / 0 / No symptom
Euphorbia geniculata / 0/75 / 0 / No symptom
Euphorbia hirta / 0/20 / 0 / No symptom
Galinsoga parviflora / 0/20 / 0 / No symptom
Malvastrum coromandelianum / 0/25 / 0 / No symptom
Parthenium hysterophorus / 0/25 / 0 / No symptom
Solanum indicum / 0/25 / 0 / No symptom
Tridex procumbens / 0/20 / 0 / No symptom
SOM Table 2. Non-hosts of croton yellow vein mosaic virus
xPlants were inoculated with 10-15 whiteflies/plant with 24 h each acquisition and inoculation access.
yThe data was added from at least two repetitions of inoculation experiments. Result was confirmed with ELISA using polyclonal antiserum to African cassava mosaic virus.
SOM Table 3.Tobacco hosts of croton yellow vein mosaic virus
Tobacco species/cultivars / SymptomsNicotiana accumianata / Leaf curl and leaf bending
N.benthamiana / Leaf curl
N. bigelovi / Dark green band and leaf bending
N.corymbosa / Leaf curl
N.goodspeedii / Vein thickening and leaf curl
N.glutinosa / Leaf curl and spreading type enation
N.hybrida / Leaf curl
N.megalosiphon / Leaf curl
N.rosulata / Leaf curl
N.rustica / Leaf bending and dark green vein
N.sylvestris / Leaf curl
N.undulatus / Leaf bending and dark green vein
N.tabacum (cultivars)
cv.Anand-2 / Dot enation
cv.Anand -119 / Dot enation
cv.Candel / Leaf curl
cv.CTRI special / Leaf curl
cv. Delcrest / Vein twisting
cv.Florida-22 / Vein twisting
cv.FCV special / Vein twisting
cv.GT-4 / Leaf curl
cv.GT-5 / Leaf curl
cv.Hicks-103 / Leaf curl
cv.Hicks special / Leaf curl
cv.Hicks Mutant / Leaf curl
cv.Jayasri / Leaf curl
cv.Kumkumathri / Leaf curl
cv.Olor / Leaf curl
cv.Oxford-3 / Leaf curl
cv.Prabha / Leaf curl
cv.PCT-7 / Leaf curl and leafy enation
cv.Samsun / Leaf curl
cv.Sona / Leaf curl
cv.Swarna / Leaf curl
cv.White burley / Leaf curl and leafy enation
cv.Xanthi / Leaf curl
