Title: Coupled promoter splicing systems
Manuel J. Muñoz1, Manuel de la Mata1, 2 and Alberto R. Kornblihtt
Laboratorio de Fisiología y Biología Molecular, Departamento de Fisiología, Biología Molecular y Celular, IFIBYNE-CONICET, Facultad de Ciencias Exactas y Naturales, Universidad de Buenos Aires, Argentina.
1. Both authors contributed equally to the manuscript.
2. Present address: Friedrich Miescher Institute for Biomedical Research PO Box 2543 4002 Basel, Switzerland
Corresponding author:
1. Abstract
We report here the experimental strategies and details to assess alternative splicing in mammalian cells transfected with reporter minigenes carrying different promoters or whose transcription is carried our by different artificial mutants of RNA polymerase II. These experiments were successfully used in our lab to demonstrate the coupling between transcription and alternative splicing and the roles of the carboxy terminal domain of RNA polymerase II in the recruitment of splicing factors and of the rate of transcriptional elongation on splice site selection.
2. Theoretical background
Splicing and alternative splicing can be duplicated in cell-free extracts when an in vitro-synthesized pre-mRNA is provided as substrate. This post-transcriptional in vitro strategy has been paramount to decipher the chemistry and molecular participants of the processing reactions. However its extensive and successful use also diverted our attention from the in vivo situation, where processing can occur co-transcriptionally and is linked to transcription. Instead, transfection of mammalian cells with reporter minigenes expressing pre-mRNA segments allows to assess both co-transcriptional and post-transcriptional splicing events and to investigate the influence of transcription on these processing events
Promoters and enhancers are cis-acting elements that control gene transcription via complex networks of protein-DNA and protein-protein interactions. While promoters deal with putting in place the RNA polymerase, both enhancers and promoters can control transcriptional initiation and elongation. The idea that the regulatory mechanisms affecting these gene elements only controlled the quantity and not the quality of their corresponding transcripts dominated our conception of gene expression for decades. Indeed, transcription and pre-mRNA processing have been thought to be independent events until a series of biochemical, cytological and functional experiments demonstrated that all three processing reactions (capping, splicing and cleavage/polyadenylation) can be tightly coupled to RNA polymerase II (pol II) transcription (reviewed in Kornblihtt, 2005).
In the present chapter will illustrate the use of constitutive and inducible promoters in minigenes designed to study the alternative splicing event better characterized in our group: the alternative cassette exon EDI (a.k.a. EDA) of the human fibronectin gene (Figure 1). This exon is 270 bp-long, presents different levels of inclusion into mature mRNA in different cell types and its splicing is affected by the promoter identity and by RNA polymerase II elongation (Cramer et al., 1997; Kadener et al., 2001; de la Mata et al., 2003)
3. Protocol:
3.1 Choosing the promoter of the minigene: Constitutive versus inducible promoters
A classical way to analyze whether the regulation of alternative splicing is cotranscriptional is testing several constitutive promoters and/or minimal promoters transactivated by different transactivation domains. For the latter, inducible promoters may also be useful whenever expression needs to be tightly controlled (see below). In our lab the “default” constitutive promoters we use in initial analysis are those of the human a-globin and fibronectin genes and also the cytomegalovirus (CMV) promoter. If the alternative splicing reporter minigene has a constitutive promoter, the transfected minigene can immediately start to transcribe and therefore there is no control of the timing of mRNA synthesis. This is the simplest system and we use it when comparing the effects of different promoters in alternative splicing decisions, cis acting mutations/deletions/insertions or when the treatment of choice requires no pre-incubation time. This strategy requires the effect to be measured after a time-lapse long enough allowing for turnover of the pre-existing mRNAs synthesized before the treatment. However, when the experiment requires a pre-incubation time, as in the case of siRNA knockdowns, overexpression of regulatory factors, endogenous pol II inhibition, etc., the initial amount of mRNA synthesized before efficient knock down, overexpression, etc, may “dilute” the real effect of the treatment analyzed. In these cases we use a tetracycline-regulated system that allows for precise induction of mRNA transcription/processing from the template minigene. This minigene carries a promoter composed basically of a tetracycline responsive element and a minimal CMV promoter (Gossens and Bujard, 1992). The advantage is that in the presence of tetracycline, transcription is mostly inhibited with only leaky transcription allowed. So, under these conditions, the quantity of mRNA synthesized before the tetracycline removal is much lower than after induction of transcription/processing by tetracycline withdrawal. For inducible expression we use two different tet-controlled transactivators, tTA-VP16 (bearing the acidic activation domain of VP16 [Gossens and Bujard, 1992]), and tTA-SP1 (bearing the glutamine rich Sp1 transactivation domain [de la Mata et al., 2006]) (Figure 2). In the absence of tetracycline the tTA-VP16 can bind to the tetracycline responsive element at the promoter activating transcription initiation and elongation whereas the tTA-SP1 activates only transcription initiation (Blau et al., 1996). An alternative way to control the correct timing of mRNA transcription induction is to perform sequential transfections (e.g. the first transfection with an siRNA and the second one with a alternative splicing reporter minigene driven by a constitutive promoter). In this case, high transfection efficiency (above 80 %) is required.
3.2 Studying the role of pol II on alternative splicing
A useful molecular tool for studying the involvement of pol II in transcription-splicing coupled reaction is the a-amanitin resistance pol II mutation (Figure 3). Different Rpb1 (RNA pol II large subunit) mutants are available, ranging from CTD-deleted to mutants with different lengths and composition of CTD heptad repeats and a “slow” pol mutant (C4 polymerase). An additional mutation confers a-amanitin resistance so that the endogenous pol II, but not the recombinant ones, can be inhibited by treating the cells with this drug. The use of an inducible/repressible system is specially preferred when the mutant pol Il variants under study display decreased transcription activity. An inducible system allows for both proper expression of the ectopic polymerases and efficient inhibition of the endogenous pol II prior to induction of the reporter minigene thus precluding the dilution of the observed effect by the pre-existing transcripts (i.e. those synthesized by the endogenous pol II). For instance, to analyze the pol II CTD requirement of a given effect we transfect the cells with the mutant polymerase, the inducible minigene and plasmids expressing its activator (i.e. tTA-SP1 and not tTA-VP16 when using the CTD-deleted mutant polymerase (Gerber et al., 1995; de la Mata et al., 2006) in the presence of tetracycline. Transcription of the minigene is then induced once the ectopic polymerase has accumulated in the cell and the endogenous pol II has been inhibited by a-amanitin.
3.3 Transfection of the alternative splicing reporter minigene.
We usually transfect hepatoma Hep3B, colorectal carcinoma HCT166, HEK293 or HeLa cells with lipofectamine or lipofectamine 2000 reagent (Invitrogen) using 2µg of total plasmid DNA of the reporter minigene and 6 µl of the transfection reagent per 3.5 mm diameter well as described in Table I and following the manufacturer’s instructions.
Minigene w/constitutive promoter / Minigene w/inducible promoterMinigene / 0.5 to 1 µg / 60 ng
Plasmid expressing tTA-VP16 or tTA-SP1 / - / 0.6 µg
siRNA or plasmid expressing the alternative splicing regulatory factor of interest / 10 ng to 500 µg
pBS or pcDNA3/3.1 / Adjust to 2 µg total DNA
· Constitutive promoter: After the recommended 4 hr incubation with the transfection reagent, add complete media (10% FCS, penicillin-streptomycin) and harvest cells 12-24 hr later for RNA extraction.
· Inducible promoter: Following the 4 hr incubation with the transfection reagent, change the media and add complete medium containing tetracycline (1µg/ml). If a longer incubation time with the transfection reagent is needed, tetracycline can be added to the transfection mix, but the toxicity must be determined in each case (i.e. for every cell line). When required, washout tetracycline 2 times with PBS and add complete medium without tetracycline to induce transcription of the minigene. When using the tTA-VP16, two to three hr post induction the cells may be harvested for RNA extraction/RT-PCR experiments (section 3.3). If tTA-SP1 is the transactivator of choice at least 5 hr of induction are needed to achieve a strong enough induction which allows to observe a clear result.
3.4 RNA extraction and RT-PCR
To analyze the alternative splicing pattern, the first step is to purify total RNA or poly A+ mRNA. A variety of commercial tools are available, like TRIzol (Invitrogen), TRI Reagent (Molecular Research Center) or RNeasy mini kit (Qiagen) for total RNA extraction and polyAtract mRNA isolation system (Promega) for poly (A)+ mRNA purification. For total RNA purification, the quality can be easily tested by agarose gel electrophoresis. To have a quick look at RNA quality there is no need for making a denature gel with formaldehyde, just prepare a regular native agarose gel and run it very fast (150/200 V) to avoid RNA degradation. Three bands must be observed, ribosomal 28S RNA, ribosomal 18S RNA and a weaker band corresponding to 5/5.8S RNA and tRNAs. Low relative amounts of the upper band is indicative of RNA degradation and must be avoided by using RNase-free materials.
Two general alternatives are available for the reverse-transcription reaction, a poly dT primer or gene specific primer (GSP). For the minigenes discussed in this chapter we use the psvcDNA as a GSP or a poly dT primer (12 to 16-mer). The reaction is performed according to manufacturer instructions using MMLV-RT (Invitrogen, Promega, Ambion, etc) and an RNase inhibitor (RNaseOUT, RNasin). For cDNA amplification by a PCR reaction, there are two major options. A quantitative real time PCR reaction or a semiquantitative end point PCR. We routinely use a radioactive semiquantitative PCR reaction to measure splicing isoforms. By using different amounts of cDNA the semiquantitative range of amplification can be easily determined. The advantage of this method is that a single pair of primers detects both isoforms at similar or identical efficiencies and regular Taq polymerase will be fine. The PCR products can be resolved by agarose gel electrophoresis. This type of analysis is mostly qualitative. A more quantitative approach is to add radioactive 32P-dCTP to the PCR reaction and to run a native 6 % PAGE (Acrylamide:Bis acrylamide 29:1) gel. The amplification products are 500 bp for the isoform including the EDI exon and 230 bp for the isoform skipping the alternative exon. The gel is then dried and the inclusion/exclusion ratio is determined by quantitation of the radioactive bands.
Primers:
· pSVcDNA: 5’GGTATTTGGAGGTCAGCA3’
· pSV5’j: 5’CACTGCCTGCTGGTGACTCGA3’
· pSV3’j: 5’GCGGCCAGGGGTCACGAT3’
PCR reaction:
· cDNA: 1 to 5 µl of a 20 µl RT reaction
· 10X Taq buffer: 5 µl
· MgCl2 50 mM: 1.5 µl
· DMSO: 1.5 µl
· pSV5’j 20 µM: 1 µl
· pSV3’j 20 µM: 1 µl
· dNTPs 10 mM: 1 µl
· Taq polymerase: 5 U/µl
· a-32P dCTP 10 µCi/µl, 3000 Ci/mmol: 0.05 to 0.1 µl
· ddH2O: complete to 50 µl
30 cycles of: 45” at 94 °C; 1’ at 63 °C; 30” a 72 °C.
4. Example of an experiment
Effect of a slow pol II mutant (hC4) in EDI alternative splicing
Transfect the following plasmids into the selected cell line:
WT pol II (pAT7Rpb1 aAmr) / hC4 pol II (pAT7Rpb1 aAmr R749H)pUHC-EDA (inducible minigene) / 70 ng / 70 ng
Plasmid expressing tTA-VP16 / 0.6 µg / 0.6 µg
Plasmid expressing a-amanitin resistant polymerase / 1.33 µg / 1.33 µg
· After 4 hr incubation with the transfection reagent, replace the culture medium and add complete medium with tetracycline (final concentration 1 µg/µl).
· Incubate for 10 to 20 hr to allow for a-amanitin resistant polymerase expression.
· Replace the culture medium by fresh medium containing a -amanitin (Sigma, final concentration 2.5 to 10 µg/ml) and tetracycline. Pre-incubate for 10 hr to allow for endogenous pol II inhibition while keeping the minigene promoter switched off.
· Wash the cells twice with PBS and add fresh culture media with a-amanitin and without tetracycline to allow for transcription by the a-amanitin resistant polymerase from the inducible minigene promoter.
· Incubate 10 to 20 hr.
· Wash the cells with PBS and harvest them for RNA extraction (TRIzol, TRI Reagent, or equivalent)
· Isolate total RNA and perform a reverse transcription reaction with poly dT primer
· Perform a radioactive PCR with pSV5’j and pSV3’j primers to analyze EDI inclusion levels.
· Prepare a 6% PAGE native gel and load half the volume of the PCR reaction.
· Run the gel for 1 hr at 15 Watts
· Dry, expose and develop the film.
· Cut bands from the gel and measure radioactivity using a scintillation counter. Calculate exon inclusion ratios with the measured values.
Results of this experiment are shown in Figure 4.
5. Troubleshooting
Problem / Reason + SolutionNo effect of mutant polymerase on EDI alternative splicing / Inefficient inhibition of endogenous pol II
· Increase pre-incubation time with α-amanitin or its concentration (up to 10 µg/ml). In any case check for cell viability
No PCR bands detected / Low mRNA quantity
· Check for transfection efficiency
· Increase incubation time after treatment and before harvesting
· If using a constitutive promoter change, when possible, to the inducible/tTA-VP16 strategy
· Check RNA isolation/cDNA preparation
· Change cell line or scale up
No effect of factor overexpression or siRNA treatment / Not enough time for expression or knock-down
· If using an inducible promoter strategy increase incubation time with tetracycline before induction.
· If using a constitutive promoter strategy increase time before harvesting or change to a sequential transfection strategy
EDI is completely included or skipped in mRNA / Try different cell lines
References
Blau, J., Xiao, H., McCracken, S., O'Hare, P., Greenblatt, J. and Bentley, D. Three functional classes of transcriptional activation domain. Mol. Cell. Biol. 16, 2044-2055 (1996).