Title Page

  1. Manuscript Title:Elevated ground-level O3negatively influences paddy methanogenic archaeal community
  2. Author List:Youzhi Feng, Xiangui Lin*, YongchangYu, Huayong Zhang, Haiyan Chu, Jianguo Zhu

1

Supplementary information I

Materials and methods

PCR-DGGE

The primer set 1106F-GC (CGCCCGCCGCGCGCGGCGGGCGGGGCGGGGGCACGGGGGGTTWAGTCAGGCAACGAGC) and1378R (CCCATGGTCCAGCGCCAGAA) was used to amplify ~320bp methanogenic archaeal 16S rRNA gene fragments1. A DCode Universal Mutation Detection System (Bio-Rad, Hercules, Calif.) was used for DGGE analysis. Approximate 150-250 ng PCR amplicons from each sample were electrophoresed on an 8% acrylamide-bisacrylamide gel, with 45% to 75% denaturant at 100V for 10 h in 1×TAE running buffer at 60°C.Thegels were stained for 20 min with SYBR Green I nucleicacid gel stain (1:10000 dilution) (Invitrogen, Oregon, USA).The gels were visualized and digitalized by using a Gel DocTM EQ imager (Bio-Rad, USA)combined with Quantity one 4.4.0 (Bio-Rad, Hercules, Calif.).The representative bands were excised, left overnight in 25 μl Milli-Qwater, reamplified and run again on the DGGE systemto ensure purity and correct mobility of the excised DGGE bands. Correct PCR products were purified using the QIAquick PCR Purification kit (QIAGEN) before cloning.

Cloning, sequencing and phylogenetic analysis

The purified PCR amplicons of the excised DGGE bands were cloned into a pMD18-T vector (TaKaRa) and transformed into Escherichia coli DH5αcompetent cell. Six random clones containing correct gene size for each DGGE band were sequenced by Invitrogen Sequencing Department in Shanghai.DNASTAR software package was used to manually check and comparethe clone sequences. One representative clone sequence with high quality after sequence comparison from each band was used for phylogenetic analysis.

Together with the topthree BLAST hits of homologous gene sequences and the gene sequences from cultured and well characterized species in GenBank, the DGGE band sequenceswere used to build a basic phylogenetic tree by theneighbor-joiningmethodusing the software package of MEGA 4.0 version (Molecular Evolutionary Genetics Analysis) 2. The tree topology was further evaluated by different methods including Minimum Evolution and Maximum Parsimony. The phylogenetic relationships of methanogenic archaeal 16S rRNAgene sequencesto the closest homolog in the GenBankwere then inferred.

Results

Paddy methanogenic archaeal community composition in response to elevated ground-level O3

The most obvious shift of methanogenic archaeal community to elevated ground-level O3 is the decrease in intensities of DGGE bands 14 and 18 on rice tillering stage (Fig. S1). The phylogenetically identification further revealed that these two band-related archaea areaffiliated with Methanosaeta (Fig. S2).

Figure S1. DGGE fingerprintingprofile of methanogenic archaeal community in paddy soils. Sample designations areindicated above each DGGElane. The bands excised forsequencing analysis areindicated by arrowednumber1 and 2.

1

Phylogenetic identification of paddy methanogenic archaea

Figure S2 Phylogenetic tree analyses showing the relationship of methanogenic archaeal 16S rRNA gene in 320 length of DGGE fingerprints in Figure S1 to the closest relatives in the GenBank.Aquifex pyrophilusacts as the outgroup. Bootstrap values of >50% based on 1000 replicates are indicated by the numbers at the nodes. Scale bar indicates the number of nucleotideacid substitutions per site.

1

Taxonomic distribution of methanogenic archaea in flooded paddy soils

Table S1 Relative abundances of detected methanogenic archaea in paddy soils combined, and in each soil sample

*All soils indicates the relative abundances of methanogenic archaea in all soils combined. #Each treatment has three replicates.

1

ANOSIM of the inter-group distances along axes 1 and 2

Table S2ANOSIM of different group distances along axes 1 and 2

Axis 1 /Axis2 / FACE-O3
Tillering / Ambient
Tillering / FACE-O3
Anthesis / Ambient
Anthesis
FACE-O3
Tillering / / / 0.43*
/0.001 / 0.001
/0.07 / 0.34
/0.36
Ambient
Tillering / / / / / 0.001
/0.04 / 0.51
/0.001
FACE-O3
Anthesis / / / / / / / 0.001
/0.65
Ambient
Anthesis / / / / / / / /

*P value

References

1.Watanabe, T., Kimura, M. & Asakawa, S. Dynamics of methanogenic archaeal communities based on rRNA analysis and their relation to methanogenic activity in Japanese paddy field soils.Soil Biol. Biochem.39, 2877-2887 (2007).

2.Tamura, K., Dudley, J., Nei, M. & Kumar, S. MEGA4: Molecular evolutionary genetics analysis (MEGA) software version 4.0.Mol.Biol. Evol.24, 1596-1599 (2007).

1