1
Online Resource 1
Optimising DNA extraction from a critically endangered marine alga
Coleman M.A. 1, 2, Weigner K.E.1, Kelaher B.P.1
1 National Marine Science Centre, Southern Cross University, PO Box 4321, Coffs Harbour, NSW Australia
2 Department of Primary Industries, National Marine Science Centre, 2 Bay Drive, Coffs Harbor, NSW 2450, Australia
* Corresponding Author: Melinda Coleman, PH: 0418431220,
Detailed methods
We trialed DNA extraction using two commercially available DNA extraction kits, the QIAGEN DNeasy Plant Kit and the MoBio PowerPlant® Pro DNA Isolation Kit. The manufacturer’s protocols were followed except that an additional wash step was done with 95% ethanol prior to elution of DNA off silica spin filters and all elutions were done in 100µl of buffer AE. The small (3mm) beads in the MoBio Powerplant® Pro kit were ineffective in homogenizing samples so we ceased to use this kit.
Using the QIAGEN kit, we extracted DNA from different amounts of starting material (25 versus 50 mg wet weight algal material that was blotted dry on paper towel), fresh (within 24 hours of collection) vs frozen material (fresh material that was snap frozen in liquid nitrogen then stored at -80 for a period of < 1 month), different forms of homogenization ((i) cryogenic grinding using liquid nitrogen in a mortar and pestle, (ii) cryogenic bead beating using one 5mm stainless steel bead in the QIAGEN TissueLyser LT and (iii) no homogenisation at all whereby algal material was placed directly into lysis buffer). The latter method was trialed because this species has “tufted” apical tips consisting of single celled filaments which may easily chemically lyse without homogenization. When frozen material was used in extractions we took care to ensure it remained frozen to avoid degradation, except for a brief period for weighting, after which, material was rapidly placed into liquid nitrogen for cryogenic grinding or immediately in lysis buffer depending on the method trialed. We also trialed extended soaking of samples in lysis buffer following homogenization but prior to extraction (2 vs. 24h in lysis buffer at 65 oC; Wilson et al. 2016). The bead beating times and frequencies trialed were 1 versus 3 minutes at 50 Hz and 1 and 3 minutes at 30 Hz.
For all extractions we used sections of the algal thallus that included both tufted apical tips and portions of the main axis taking care to use similar sections (and proportions of tips/main axis) for all extractions. All extractions were done using 4 large Nereia lophocladia individuals that were found as fresh drift material in excellent condition (no obvious degradation etc). These specimens were large enough so that sufficient material was available from each of the 4 specimens to use as replicates in trials of each method, thus minimizing inherent variation associated with efficacy of DNA extraction among many different individuals. All DNA concentrations were assessed using a QubitTM fluorometer.
A selection of low-yield samples that were extracted using the optimal method (cryogenic grinding using a mortar and pestle with soaking times of 2h) were pooled (450µl at 6.2ng/µl) and cleaned up using the MoBio PowerClean DNA cleanup kit following the manufacturers instructions, and eluted into 30µl of elution buffer. This yielded excellent quality DNA with NanoDrop ratios of 1.84 and 2.42 for the 260:280 and 260:230 ratios respectively and a concentration of 38.4ng/µl equating to a 60% loss of DNA. Thus, with extractions from 25mg of a single sample having an average concentration of ~15ng/µl in 100µl (Fig 1a), post hoc cleanup into 30µl would result in a final concentration of 20ng/µl which is more than sufficient for restriction enzyme digestion and downstream NGS applications.
To test DNA for suitability in subsequent NGS applications (Peterson et al. 2012) we did double restriction digestions using combinations of PstI-HF or EcoRI-HF as the common cutters, with each of MspI, MseI, NlaIII and HpyCH4IV (New England Biolabs; NEB) as the rare cutters. The reactions were done in a total volume of 20µl with 2µl NEB CutSmart buffer, 6.8µl water, 10µl of DNA (50ng), 0.4µl PstI-HF (lane 2 to 5) or EcoRI-HF (lanes 7 to 10) and either 0.4µl MspI and 0.4µl water (lanes 2 and 7), 0.8µl, MseI (lanes 3 and 8), 0.8µl NlaIII (lanes 4 and 9) or 0.8µl HpyCH4Iv (lanes 5 and 10) then incubated at 37oC for 2 hours followed by inactivation at 65oC for 20 minutes. Products (18µl) were run on a gel (lanes above refer to Fig 2) against a low mass ladder with a smear indicating digestion efficacy. These double digests were considered a good test for the suitability of DNA in subsequent NGS applications such as genotyping by sequencing (GBS) or analogous methods such as double digest RADSeq (Peterson et al. 2012) because inhibitors in algal DNA (e.g. polysaccharides that make algal extracts thick) can inhibit digestion by restricting enzyme access to DNA. In addition, our previous work on other algal species suggests that obtaining DNA of sufficient quality for digestion is the limiting step for success with such techniques.
Similarly, to test the suitability of DNA for PCR reactions we amplified diluted DNA (1:100) using an rbcL gene (Peters and Ramírez 2001). PCR was done in 12.5µl volume consisting of 1.5µl diluted DNA, 0.5µl each of 10 µM forward (rbcL95F; ATGGGATATTGGGATGCTGA) and reverse (rbcL1080R; GAGATGCCCAATCCATATC) primers, 6.25µl MyTaqHS Mix (Bioline, Australia) and 3.75µl water. Cycling conditions were 60s at 95 oC followed by 35 cycles of 95oC (15s), 55 oC (15s), 72 oC (10s) then 10s at 72 oC.
Throughout, DNA quality was qualitatively assessed by gel electrophoresis whereby good quality DNA is determined by the presence of high molecular weight bands on a gel with no or minimal smearing. Quality was also quantitatively assessed via assays on a NanoDrop 2000 Spectrophotometer with 260:280 ratios of ~1.8 and 260:230 ratios >1.2 indicating good quality DNA with minimal contamination. DNA concentration was determined using the QubitTM Fluorometer and we define “sufficient” DNA for NGS as a concentration of at least ~8ng/µl in 100µl (or 800ng of DNA) which allowed for contingencies associated with ~60% loss from post hoc cleanup.
Table S1. PERMANOVA of DNA extraction methods with planned contrasts for relevant comparisons. No contrasts were done for methods involving no homogenisation (NH) because of low replication (n = 2). ** = P < 0.01, * = P < 0.05.
Source / d.f. / MS / Pseudo-F / P (MC)Method / 5 / 1708.6 / 9.193 / 0.001 / **
C1 (Fresh MP v Frozen MP) / 1 / 285.3 / 3.603 / 0.099
C2 (Frozen MP v Frozen QTL) / 1 / 206.2 / 7.791 / 0.022 / *
C3 (Frozen QTL v Frozen QLT 24h) / 1 / 2295.4 / 8.705 / 0.010 / *
Residual / 27 / 185.9
References
Peterson BK, Weber JN, Kay EH, Fisher HS, Hoekstra HE (2012) Double digest RADSeq: an inexpensive method for de novo SNP discovery and genotyping in model and non-model species PLoSOne 7(5): e37135. doi:10.1371/journal.pone.0037135
PetersAF,RamírezME(2001)Molecular phylogeny of small brown algae, with special reference to the systematic position ofCaepidium antarcticum(Adenocystaceae, Ectocarpales).Cryptogamie Algol. 22:187–200.