Table S1. The six whole–tree tests of diversification rate variation in the cyprinid phylogeny by batch analysis of the bootstrap profile of trees from ML analysis under unpartitioned strategy using RAxML.

Statistic / IC / MΠ* / MΠ / MΣ* / MΣ / B1
High / 0.00946 / 0.00077 / 0.00485 / 0.00314 / 0.06172 / 0.3524
Low / 0.01006 / 0.00107 / 0.00793 / 0.0052 / 0.10703 / 0.4003
Mean / 0.009718 / 0.00095 / 0.00645 / 0.004094 / 0.083688 / 0.37156

The high and low asymmetry values correspond to the tail probabilities for the 0.025 and 0.975 frequentiles, respectively.

Table S2. Results of fitting diversification models to the Cyprininae using Birth-Death Likelihood.

pureBirth / BD / DDX / DDL / yule2rate / yule3rate
Parameters / r1=0.001145195 / r1=0.001145195 / r1=0.001145195 / r1=0.001565919 / r1=0.002849767 / r1=0.002849767
α=0 / x=0 / K=242.2569 / r2=0.0009948618 / r2=0.000903284
st=1600.337 / r3=0.001756760
st=1600.337
st2=91.3093
Ln(L) / -467.077 / -467.077 / -467.077 / -466.5369 / -458.5662 / -455.7666
AIC / 936.154 / 938.154 / 938.154 / 937.0739 / 923.1324 / 921.5333
ΔAICrc / -2 / -2 / -0.9199 / 13.0216 / 14.6207

Table S3. PCR primers (names, sequences and references) to amplify three mitochondrial and one nuclear DNA genes.

Genes / Primer name / Primer sequence (5'-3') / Cited source
16S / 16Sp1F / CTTACACCGAGAARACATC / Li et al., 2008
16Sp1R / CTTAAGCTCCAAAGGGTC
ND4 / L11264 / ACGGGACTGAGCGATTAC / This study
H12320 / AATCATTTGTAGTCCTCGGGCGAG
COI / L5257 / TCWTAGTTAACAGCTAAGC / Miya & Nishida, 2000
COI-H6855 / RAAGTGRCAGAGYGGTTATG
Cyt b / L14724 / GACTTGAAAAACCACCGTTG / Xiao et al., 2001
H15915 / CTCCGATCTCCGGATTACAAGAC
Rag2 / RAG2-f2a / ArACGCTCmTGTCCmACTGG / Lovejoy & Collette, 2001
RAG2-R6a / TGrTCCArGCAGAAGTACTTG

References

1. Li J, Wang X, Kong X, Zhao K, He S, et al. (2008) Variation patterns of the mitochondrial 16S rRNA gene with secondary structure constraints and their application to phylogeny of cyprinine fishes (Teleostei: Cypriniformes). Mol Phylogenet Evol 47: 472-487.

2. Miya M, Nishida M (2000) Use of Mitogenomic Information in Teleostean Molecular Phylogenetics: A Tree-Based Exploration under the Maximum-Parsimony Optimality Criterion. Mol Phylogenet Evol 17: 437-455.

3. Xiao W, Zhang Y, Liu H (2001) Molecular Systematics of Xenocyprinae (Teleostei: Cyprinidae): Taxonomy, Biogeography, and Coevolution of a Special Group Restricted in East Asia. Mol Phylogenet Evol 18: 163-173.

4. Lovejoy NR, Collette BB, McEachran JD (2001) Phylogenetic Relationships of New World Needlefishes (Teleostei: Belonidae) and the Biogeography of Transitions between Marine and Freshwater Habitats. Copeia 2001: 324-338.