EXAM 1 REVIEW
Supplemental Instruction
Iowa State University / Leader: / Lilli Howard
Course: / BIOL/GEN 313
Instructor: / Dr. Myers
Date: / 02/02/14

CHAPTER 1

  1. What are the three fields of genetics? When do you use them?
  1. What are some characteristics of model organisms? What are some examples of model organisms?
  1. What are some implications of all organisms having similar genetic systems?

CHAPTER 10 (DNA)

  1. Even before the discovery of nucleic acids were the genetic material, scientists knew the genetic material must possess 3 characteristics. What were they?
  1. Each nucleotide contains _____ parts. Draw them in a simplified format.

Know how to identify each possible base: A, T, C, G, U

  1. What was the conclusion of the Griffith experiment?
  1. What was the conclusion of the Avery, MacLeod, and McCarty experiment?

8. What was the conclusion of the Hershey & Chase experiment?

9. Which of the following types of chemical bonds or effect are NOT responsible for formation of the helical structure of double stranded DNA?

a) Hydrogen bonds between heterocyclic bases

b) Hydrophobic effect to shield bases from interaction with water

c) Covalent bonds between heterocyclic bases

d) van der Waals bonds between heterocyclic bases

e) None of the above, all of these forces are involved in formation of the helical structure

10. For the following single strand of DNA, write in the complementary strand. How many 3' hydroxyl groups are present? What is located on the free 5' end? How many Hydrogen bonds act between the molecules? How many purines and pyrimidines are present?

5' - AATAGCGGATGCCCGAATACGAG - 3'

11. Compare the structures of DNA and RNA:

Characteristic / DNA / RNA
Composed of nucleotides (Y/N)
Type of sugar
Presence of 2' OH group (Y/N)
Bases Included
Phosphodiester Bonds (Y/N)
Double or Single Stranded
Secondary Structure
Stability

12. The anti-parallel nature of DNA refers to:

a. its charged phosphate groups

b. the pairing of bases on one strand with bases on the other strand

c. the formation of hydrogen bonds between bases from the opposite strands

d. the opposite direction of the two strands of nucleotides

13. Hairpins are formed in DNA as a result of:

a. sequences on the same strand that are inverted and complementary

b. sequences on the opposite strand that are complements

c. sequences on the same strand that are identical

d. sequences on the opposite strand that are identical

CHAPTER 11 (Chromosomes)

14. A DNA molecule 300 bp long has 20 complete rotations. This DNA molecule is:

a. positively super-coiled

b. negatively super-coiled

c. relaxed

15. Super-coiling relies on enzymes that add or remove rotations called ______.

16. Order of packing steps:

1. ______4. ______7. ______

2. ______5. ______

3. ______6. ______

17. What is the difference between euchromatin and heterochromatin? Which contains puffs?

18. Neutralizing their positive charges would have which effect on the histone proteins?

a. they would bind the DNA tighter

b. they would separate from the DNA

c. they would no longer be attracted to each other

d. they would cause super-coiling of DNA

19. How many copies of H2B histone would be found in chromatin containing 50 nucleosomes?

a. 5

b. 10

c. 50

d. 100

20. What is a telomere? What are three defining characteristics?

21. Describe unique-sequence, moderately repetitive and highly repetitive DNA. In which are most genes located?

22. Which of the following statements about centromeres is FALSE?

a) Centromers are the regions of chromosomes to which spindle fibers attach during mitosis

b) Centromeres typically are made up of thousands of direct repeats of short DNA sequences

c) Centromeres are densely populated with active genes

d) Centromeres are usually heterochromatic

e) Centromeric DNA is packaged into chromatosomes

CHAPTER 12 (Replication)

23. Describe Meselson and Stahl's experiment? What did it tell us?

24. Draw a replication bubble including: replication fork, 5' and 3' ends, leading and lagging strands, origin of replication, primers.

25. What are the four requirements of replication?

26. Discontinuous replication is a result of which proptery of DNA?

a. complementary bases

b. charged phosphate group

c. anti-parallel nucloetide strands

d. five carbon sugar

Study Table 12.4 on page 334

27. Describe the activities of DNA Polymerase I and III. What are the differences?

28. What role does replication licensing factor play in eukaryotic replication?

29. What would be the result if an organism's telomerase were mutated and non-functional?

a. No DNA replication would take place

b. The DNA polymerase enzyme would stall at the telomere

c. Chromosomes would shorten with each new generation

d. RNA primers could not be removed

30. Which of the following is NOT present in the DNA replication complex?

a) DNA polymerase I

b) DNA polymerase III

c) primase

d) helicase

e) telomerase

CHAPTER 13 (Transcription) Fig. 13.12 & 13.13 on page 361 and 362 can be helpful

31. What are the names and activities of the following
a. mRNA:______

b. rRNA:______

c. tRNA:______

32. Which of the following phrases does not describe a function of the promoter?

a. Serves as sequence to which transcription apparatus binds

b. Determines the first nucleotide that is transcribed into RNA
c. Determines which DNA strand is template

d. Signals where transcription ends

33. Name and describe the three stages of transcription.

34.What are the components of the holoenzyme in bacterial transcription? What is its purpose?

35. Describe the two kinds of termination present in bacteria. How are they different from eukaryotic termination?

36. What is the difference between the core promoter and the regulatory promoter?

a. Only the core promoter has consensus sequences

b. The regulatory promoter is farther upstream of the gene

c. Transcription factors bind to the core promoter; transcriptional activator proteins bind to the regulatory promoter

d. Both b and c

37. An RNA molecule has the following percentage of bases: A = 23%, U = 42%, C = 21%, G = 14%. What is the percentage of T bases in the non-template strand of the double stranded DNA

that is copied to generate this RNA?

a) 23%

b) 42%

c) 21%

d) 14%

e) not enough information to determine

CHAPTER 14 (RNA Molecules and Processing)

38. What evidence indicated that eukaryotic genes are not colinear with their proteins?

39. What is the difference between introns and exons? How are introns removed?

40. After cleavage of the transcript during termination, a run of A residues is added to the 3’ end. What is this called? Why does it happen?

41. Numerous processing steps convert the initial transcript molecule (pre-mRNA) into mature mRNA. What are the three that we talked about?

42. Which of the following elements is NOT present in a mature mRNA molecule?

a) protein-coding region

b) 3' untranslated region

c) 5' untranslated region

d) promoter

e) translational start codon

43. Which of the following is present on a pre-mRNA molecule but is not found in the mature

mRNA produced from the at pre-mRNA?

a) exons

b) translational start codon

c) translational stop codon

d) introns

e) 5' CAP structure

44. If a splice site were mutated so that splicing did not take place, what would be the effect on the mRNA?

a. It would be shorter than normal

b. It would be longer than normal

c. It would be the same length but would encode a different protein

1060 Hixson-Lied Student Success Center  515-294-6624  