Co-supplementation of isomalto-oligosaccharides potentiates metabolic health benefits of polyphenol-rich cranberry extract in high fat diet-fed mice via enhanced gut butyrate production.
European Journal of Nutrition
DhirendraPratap Singh1,2, Shashank Singh1, Vandana Bijalwan1, Vijay Kumar1, Pragyanshu Khare1, Ritesh Kumar Baboota1,3, Paramdeep Singh1, Jagdeep Singh1, KanthiKiran Kondepudi1,**, Kanwaljit Chopra2,**, Mahendra Bishnoi1,**
1National Agri-Food Biotechnology Institute (NABI), S.A.S. Nagar (Mohali), Punjab, India-160071
2 Pharmacology Division, University Institute of Pharmaceutical Sciences (UIPS), Panjab University, Chandigarh, India 160014
3Dept. of Pharmaceuticaland Pharmacological Science, KatholiekeUniversiteit Leuven, Belgium (present address)
**Correspondences:
Dr. MahendraBishnoi, Ph.D.
Dr. KanthiKiranKondepudi, Ph.D.
E-mail: (MB); (KKK)
Prof. Kanwaljit Chopra, Ph. D.
Email:
Online resource 2: List of bacterial primers used in the study
Bacterial primers / Forward 5’-3’ / Reverse 5’- 3’ / ReferenceAKK / CAGCACGTGAAGGTGGGGAC / CCTTGCGGTTGGCTTCAGAT / [1]
ANERO / CTCAACTCCGGGACTGCTTT / GTTTACGGCGTGGACTACCA / This study
BACT / ACGCTAGCTACAGGCTTAACA / ACGCTACTTGGCTGGTTCA / [1]
BFRAG / GATGGGGATGCGTTCCATTA / TCATCCTTCACGCTACTTGGC / This study
BIF / TCGCGTCYGGTGTGAAAG / CCACATCCAGCRTCCAC / [1]
BPULL / TGGAAGTGAAATCTCGGGGC / GTTTACGGCGTGGACTACCA / This study
BVIB / ACAGGGGGATAGCAGTTGGA / CTGCCTCCCGTAGGAGTTTG / This study
CITRO / CTCAAAGGAGACTGCCAGTG / GCATTCTGATCCACGATTACTA / This study
CLEP / CGGGTGAGTAACGCGTGAGT / AACCTCTCAGTCCGGCTACC / This study
CPROP / ACATCCCTCTGACCGGTGTA / CGTGTTATCCACGGCAGTCT / This study
ECOL / AAGCTTGCTCTTTGCTGACG / CCGTTACCCCACCTACTAGC / This study
ENT / CCCTTATTGTTAGTTGCCAT / ACTCGTTGTACTTCCCATTG / This study
ENTB / CATGACGTTACCCGCAGAAG / CTCTACGAGACTCAAGCTTG / [2]
EUBACT / GCTGTGAAGCCGAGCAAATC / GGTTAGGTCACTGGCTTCGG / This study
FEC / GAGGAAGATAATGACGGTAC / ACCTCTGCACTACTCAAGA / [3]
FIRM / GCGTGAGTGAAGAAGT / CTACGCTCCCTTTACAC / [4]
gCCoC / AAATGACGGTACCTGACTAA / CTTTGAGTTTCATTCTTGCGAA / [5]
KLEB / GCAAGACCAAAGTGGGGGA / CATGGCTGCATCAGGCTTGCGC / This study
LAB / CACCGCTACACATGGAG / AGCAGTAGGGAATCTTCCA / [1]
LACH / CGGTACCTGACTAAGAAGC / AGTTTYATTCTTGCGAACG / [6]
PREVO / GATGGGGATGCGTCTGATTAG / TCCTGCACGCTACTTGGCT / This study
ROS / GCGGTRCGGCAAGTCTGA / CCTCCGACACTCTAGTMCGA / [4]
SFB / AGCGAACGGGTGAGTAACAC / GGACCGTGTCTCAGTTCCAT / This study
Total Bacteria / ACTCCTACGGGAGGCAGCAGT / ATTACCGCGGCTGCTGGC / [4]
AKK = Akkermansia sp., ANERO = Anaerostipesbutyraticus, BACT = Bacteroidetes, BFRAG = Bacteroides sp., BIF = Bifidobacteria, BPULL = Butyricicoccuspullicaecorum, BVIB = Butyrivibrio sp., CITRO = Citrobacter sp., CLEP = Clostridium sp., CPROP = Clostridium propionicum, ECOL = Escherichia coli, ENT = Enterobacter sp., ENTB = Enterobacteriaceae, EUBACT = Eubacterium sp., FEC = Faecalibacterium sp., FIRM = Firmecutes, gCCoC = Clostridium coccoides group, KLEB = Klebsiella sp., LAB = Lactobacillus sp., LACH = Lachnospiraceae, PREVO = Prevotella sp., ROS = Roseburia sp., SFB = Segmented filamentous bacteria
References:
[1] Baboota RK, Murtaza N, Jagtap S, Singh DP, Karmase A, Kaur J, et al. Capsaicin-induced transcriptional changes in hypothalamus and alterations in gut microbial count in high fat diet fed mice. J Nutr Biochem. 2014;25:893-902.
[2] Singh DP, Khare P, Zhu J, Kondepudi KK, Singh J, Baboota RK, et al. A novel cobiotic-based preventive approach against high-fat diet-induced adiposity, nonalcoholic fatty liver and gut derangement in mice. Int J Obes. 2016;40:487-96.
[3] Lopez-Siles M, Martinez-Medina M, Abella C, Busquets D, Sabat-Mir M, Duncan SH, et al. Mucosa-associated Faecalibacterium prausnitzii phylotype richness is reduced in patients with inflammatory bowel disease. Appl Environ Microbiol. 2015;81:7582-92.
[4] Murtaza N, Baboota RK, Jagtap S, Singh DP, Khare P, Sarma SM, et al. Finger millet bran supplementation alleviates obesity-induced oxidative stress, inflammation and gut microbial derangements in high-fat diet-fed mice. Br J Nutr. 2014;19:1-12.
[5] Matsuki T, Watanabe K, Fujimoto J, Miyamoto Y, Takada T, Matsumoto K, et al. Development of 16S rRNA-gene-targeted group-specific primers for the detection and identification of predominant bacteria in human feces. Appl Environ Microbiol. 2002;68:5445-51.
[6] Walker AW, Martin JC, Scott P, Parkhill J, Flint HJ, Scott KP. 16S rRNA gene-based profiling of the human infant gut microbiota is strongly influenced by sample processing and PCR primer choice. Microbiome. 2015;3:26.
