Karla Lightfield Assessment Residency 2015
Assignment 2, Part 2:
One area my students struggle with in my microbiology class is the regulation of gene expression. My goal in this unit is to help them understand how the presence of a gene in a genome does not necessarily mean the protein will be expressed and stable. I also want them to understand the various mechanisms by which this expression can be altered, the consequences of these modifications, and what circumstances might lead to each type of regulation.
Example learning objectives for this unit:
Lower order:
*State the organization of a gene (including regulatory regions) for an individual gene and an operon.
* Describe the series of events that leads to the expression of a functional protein in a bacterial cell starting with DNA.
Higher order:
* Compare and contrast the potential effects of a given mutation in an open-reading frame to a mutation in a regulatory region.
* Describe how bacteria can regulate gene expression at the level of transcription and translation.
In class activity:
In order to begin addressing these objectives I slightly modified some in class activities from “A Collection of In-Class Activities in Microbiology” ~Susan Merkel, editor, from microbe library. My class has bout 120 students, so I had them work individually, then in small groups to work through the problems. I then polled them using clickers to assess their progress. I’ve attached the entirety of my in class activity (3 class periods) below.
Formative Assessment:
In addition to the clicker questions with the in class activity I used a second formative assessment I used in class group quizzes using IFAT forms. These quizzes allow them to discuss their answers with their group and give them immediate feedback once they answer.
Example quiz question: About 30% of the groups missed on their first try, but nearly 100% were correct on try 2
Given the following template strand of DNA, please provide the corresponding mRNA sequence. You can assume that the appropriate consensus sequence was present and begin your transcription immediately at start of the appropriate end of the DNA.
5’-ACGTCGGTATG-3’
A. 5’-CATACCGACGT-3’
B. 3’-CAUACCGACGU-5’
C. 5’-ACGUGCCUAUC-3’
D. 3’-ACGUGCCUAUC-5’
E. 5’-CAUACCGACGU-3’
Summative assessment:
My summative exams are given on an individual basis and taken in class using scan-trons. Here is an example question addressing the learning objectives above:
Example summative: Only about 60% of the students got this question correct on the exam, however it had a very high discrimination index. People who got this question right tended to be the ones who did well on the exam as a whole.
You experimentally change the DNA sequence directly upstream of a start codon of an operon in E. coli to investigate the function of this region of DNA. Analysis reveals that after the change the same amount of mRNA is made from the operon, but there are very few proteins made from the operon. What is the most likely function of the DNA sequence that you changed?
A) The DNA sequence likely functions as a ribosome-binding site.
B) The DNA sequence likely functions as a promoter.
C) The DNA sequence likely functions as a termination sequence.
D) The DNA sequence likely functions as in transcriptional regulation.
In Class Activity
1. DNA Replication
There are many important enzymes involved in the replication of bacterial DNA. Please place the following phrases in the correct order for replication of the bacterial chromosome.
A. Binding proteins stabilize the double Helix
B. DNA polymerase III adds complementary nucleotides
C. DNA gyrase removes DNA supercoils
D. Topoisomerase IV separates linked chromosomes
E. DNA polymerase I replaces the RNA primer
F. DNA helicase unwinds the DNA double helix
G. Primase generates and RNA primer that binds to the origin
H. DNA ligase seals any nicks in the DNA
It may help to draw the process on the side!
1.
2.
3.
4.
5.
6.
7.
8.
2. Polymerases:
Place the following terms in the appropriate bins
A) polymerizes bonds between ATC and G. B) Polymerizes bonds between AUC and G.
C) binds to a promoter. D) adds nucleotides to the 3’-OH position
E.) binds to a primer F) requires and RNA primer
G) generates an RNA product H) required for replication
I) Is a family of 5 different polymerases
DNA polymerase RNA polymerase
3. Transcription Shown below is a nucleotide sequence of a fragment of double-stranded DNA from E. coli.
5'..TCTACGCATCTAGCGGGCTCTTGACA(17bases)TATAATGCTCAATTGTCGCTAAGGAGGTGCTTGATGATCTGGCGAC 3'..AGATGCGTAGATCGCCCGAGAACTGT(17bases)ATATTACGAGTTAACAGCGATTCCTCCACGAACTACTAGACCGCTG
Assume that the E. coli consensus promoter is:
5'...TTGACA...(any 17 bases)...TATAAT...3'
3'...AACTGT...(any 17 bases)...ATATTA...5'
1.What molecule recognizes and binds to the promoter region?
2. What molecule carries out transcription of DNA?
3. In which direction does transcription take place (left or right on the diagram above)? What determines the direction of transcription?
4. Which DNA strand will be actively transcribed? What determines which DNA strand gets copied?
5. Write out the mRNA that will be transcribed from this gene, include 5' and 3' ends.
6. On your diagram of the mRNA, indicate the position of the first translated codon. What is this codon?
7. What is the second amino acid in this polypeptide?
8. What is the sequence of the anti-codon region of this tRNA? Include 5' and 3' ends.
4. Translation
a) Which mRNA and peptide is generated from the following sequence?
5’–CTAGTAGATACG1TCCCATG2–3’
b) How would the sequence change if G2 were deleted?
c) How would the sequence change if G1 were deleted?