Supplement1List of consensus primer sets amplifying polymorphic region of mtDNA among six Korean ginseng cultivars,P. quinquefolius, and P. notoginseng. Degenerate positions are R (=A or G), W (=A or T) and Y (=C or T)

Primera ID / Location / Forward and reverse primer sequences (5’→3’) / AT (℃)b / PCR Size(bp) c / P d / Enzymes e / Discriminated species or cultivars
mt6 / ccb452-ccb452 / TATTACCAGACATAATTGGG
TGAACTGTATCTTCTTTGTG / 55→50.5, 50 / 1300 / M / Alu I, Hae III, Hinf I,
Taq I, Tsp509 I / P. quinquefolius
P. notoginseng
mt7 / cox1-cox1 / TTGTTACGACCACGAAGA
TCGGTGCCATTGCTGGAG / 60→55.5, 55 / 1300, 2100 / P / Alu I, Hae III, Hinf I,
Rsa I, Taq I, Tsp509 I / P. quinquefolius
mt9 / cox2/2-coc2/3 / TAGRAACAGCTTCTACGACG
GRGTTTACTATGGTCAGTGC / 63→58.5, 58 / 2000 / M / Alu I, Hae III, Hinf I,
Rsa I, Taq I, Tsp509 I / P. quinquefolius
P. notoginseng
Gopoong
mt11 / nad1/2-nad1/3 / GCATTACGATCTGCAGCTCA
GGAAGCCGATTAGTTTCTGC / 60→55.5, 55 / 1200,1300
and 1400 / P / Alu I, Hae III, Hinf I,
Rsa I, Taq I, Tsp509 I / P. quinquefolius
P. notoginseng
mt13 / nad2/1-nad2/2 / AATGTGGGTTGGCTTGGWTT
AATATGTAAAATTGTCCCTC / 65→60.5, 60 / 1100, 1200 / P / Alu I, Hae III, Hinf I,
Rsa I, Taq I, Tsp509 I / P. quinquefolius
P. notoginseng
mt18 / nad4/3-nad4/4 / GGAGCTTTCCAAAGAAATAG
GCCATGTTGCACTAAGTTAC / 60→55.5, 55 / 2200, 2800 / P / Alu I, Hae III, Hinf I,
Rsa I, Taq I, Tsp509 I / P. notoginseng
mt19 / orf25-nad4L / CTGTYTTTTCGCACTTAGGC
GTCCGRGGTACTATTGCTGT / 55→50.5, 50 / 550 / M / Hae III, Hinf I, Taq I,
Tsp509 I / P. notoginseng
mt20 / nad5/1-nad5/2 / TTTTTTCGGACGTTTTCTAG
TTTGGCCAAGTATCCTACAA / 60→55.5, 55 / 2200 / M / Hinf I / P. notoginseng
mt21 / nad5/4-nad5/5 / CCAATTTTTGGGCCAATTCC
CATTGCAAAGGCATAATGAT / 63→58.5, 58 / 1400 / M / Alu I, Hae III, Hinf I,
Rsa I / P. notoginseng
mt24 / nad7/2-nad7/3 / GCTTTACCTTATTCTGATCG
TGTTCTTGGGCCATCATAGA / 60→55.5, 55 / 1300 / M / Alu I, Hae III, Hinf I,
Rsa I, Taq I / P. quinquefolius
P. notoginseng
mt34 / rrn5-rrn18 / GAGGTCGGAATGGGATCGGG
CGTAASGCGTGGGAATCTGC / 60→55.5, 55 / 1800 / M / Alu I, Hae III, HInf I,
Rsa I, Taq I, Tsp509 I / P. notoginseng

a Primer IDs were re-named based on Duminil et al.[30].

b A temperature range of touch-down PCR and annealing temperature used in the reactions of each primer set.

c An approximate PCR product size was measured based on DNA ladder marker (2-Log DNA ladder; NEB).

d Polymorphisms by PCR amplification,‘M’: monomorphisms; ‘P’: polymorphisms.

e Endonucleases detecting polymorphisms when treated to PCR products amplified by each primer set.

Supplement 2Length polymorphism by PCR amplification using the consensus primer sets of mtDNA among six Korean ginseng cultivars,P. quinquefolius,and P. notoginseng, lane 1, Chunpoong; lane 2, Yunpoong; lane 3, Gopoong; lane 4, Kumpoong; lane 5, Sunpoong; lane 6, Sunwon; lane 7,P. quinquefolius; lane 8,P. notoginseng. (A) mt7, (B) mt11, (C) mt13 and (D) mt18. Lane ‘M’:the DNA step ladder ‘M’: 2-Log DNA ladder (NEB). Arrows indicate polymorphic fragments

Supplement 3 CAPS polymorphism between Korean ginseng cultivars and foreign Panax species.PCR products of (A) mt11 and (B) mt13 were cleaved by six endonucleases (Alu I,Hae III,Hinf I,Ras I,Taq I, and Tsp509 I). Lane 1, Chunpoong; lane 2, Yunpoong; lane 3, Gopoong; lane 4, Kumpoong; lane 5, Sunpoong; lane 6, Sunwon; lane 7,P. quinquefolius; lane 8,P. notoginseng. Lane ‘M’: 100bp DNA ladder (Promega; Madison, USA). Arrows indicate polymorphic fragments.

Supplement 4 Reproducibility tests on CAPS polymorphism with Hinf I (A) and Tsp509 I (B) in cox2 region amplified mt9 primer by using multiple samples from different localities.lane 1-2, Chunpoong (Eumseong); lane 3, Chunpoong (Pyeongchang); lane 4, Chunpoong (Geumsan); lane 5-6, Yunpoong (Eumseong); lane 7-8, Gopoong (Eumseong); lane 9, Gopoong (Pyeongchang); lane 10, Gopoong (Geumsan); lane 11-12, Kumpoong (Eumseong); lane 13, Kumpoong (Pyeongchang); lane 14, Kumpoong (Geumsan); lane 15-16, Sunpoong (Eumseong); lane 17,Sunpoong (Pyeongchang); lane 18,Sunpoong (Geumsan); lane 19-20, Sunwon (Eumseong); lane 21,Sunwon (Pyeongchang); lane 22,Sunwon (Geumsan); lane 23-26,P. quinquefolius (Wisconsin); lane 27-30,P.notoginseng. Lane ‘M’: 100bp DNA ladder (Promega).Squares indicate polymorphic fragments.