Table S1- Taqman Qpcr Primers/Probes and Endpoint PCR Primers Used in This Study

Gene symbol / Gene name / Taqman accession / Location (exon boundary) / Assay function / Primer/probe sequence
ACTB / β actin / Hs99999903_m1 / exon 1-1 / housekeeper / -
GAPDH / glyceraldehyde-3-phosphate dehydrogenase / Hs99999905_m1 / exon 3-3 / housekeeper / -
TBP / TATA-binding protein / Hs00427620_m1 / exon 2-3 / housekeeper / -
UBC / ubiquitin C / Hs00824723_m1 / exon 1-2 / housekeeper / -
NR3C2 (MR) / mineralocorticoid receptor / Hs01031809_m1 / exon 6-7 / target transcript / -
NR3C1 (pan GR) / glucocorticoid receptor / Hs00230818_m1 / exon 7-8 / target transcript / -
GRβ / glucocorticoid receptor β / Hs00354508_m1 / exon 8-9 / target transcript / -
GR-‘A’ Fwd / glucocorticoid receptor ‘A’ / Taqman custom / exon 4/8 junction / target transcript / GAAAATGTCTTCAGGCTGGAATG
GR-‘A’ Rvse / glucocorticoid receptor ‘A’ / Taqman custom / exon 4/8 junction / target transcript / TGGCTTTTCCTAGCTCTTTGATGT
GR-‘A’ probe / glucocorticoid receptor ‘A’ / Taqman custom / exon 4/8 junction / target transcript / ACCTGGAAGTTCCTAAGGA
GR-‘A’ 2Fwd / glucocorticoid receptor ‘A’ / endpoint PCR / exon 2 / target transcript / ATGGACTCCAAAGAATCATTAAC
GR-‘A’ 3Fwd / glucocorticoid receptor ‘A’ / endpoint PCR / exon 3 / target transcript / ATGAGACCAGATGTAAGCTCTC
GR-‘A’ 4/8Rvse / glucocorticoid receptor ‘A’ / endpoint PCR / exon 4/8 junction / target transcript / TAGGAACTTCCAGGTTCATTCC
GR-‘A’ 4/8Fwd / glucocorticoid receptor ‘A’ / endpoint PCR / exon 4/8 junction / target transcript / AACCTGGAAGTTCCTAAGGACG
GR-‘A’ 9αRvse / glucocorticoid receptor ‘A’ / endpoint PCR / exon 9α / target transcript / ATTTCAGCTAACATCTCGGGG
GR-‘A’ 9βRvse / glucocorticoid receptor ‘A’ / endpoint PCR / exon 9α / target transcript / AATGTGTGAGATGTGCTTTCTGG

Table S1- Taqman qPCR primers/probes and endpoint PCR primers used in this study.

Figure S1. Preabsorption of GRα antibody sc1002X with blocking peptide. Increasing ratios (vol:vol) of blocking resulted in almost complete amelioration of antibody binding, while increasing ratios of unrelated peptide had no effect. IR- immunoreactive, kDa- kilodalton, Ab- antibody, Con- control case, Scz- schizophrenia case.

Figure S2. qPCR Amplification plots with GR Taqman probes. (A) strong amplification of undiluted and serially diluted DLPFC cDNA samples with the pan GR Taqman probe, (B) absence of amplification in all but one well of undiluted and serially diluted DLPFC cDNA samples with the GRβ Taqman probe, (C) moderate amplification of undiluted and serially diluted HeLa cDNA samples with the GRβ Taqman probe.