Table1 the Primers of Genes Used in Real-Time RT-PCR

Table1 the Primers of Genes Used in Real-Time RT-PCR

Supplementary Table1. The primers of genes used in Real-time RT-PCR

Gene ID / Sense primer / Antisense primer / Product length(bp)
Increased
genes / RAPGEF2 / CAGCTTGGTTTTCCCTCCTC / GCTGGGATTGCTAGTGGTTTC / 152
CCDC88A / TGATTTTGTGCCAGGGATTC / GTTCCGACCTCTACACGTTCC / 268
PPP1R12A / CGGAACGAGCAGCTGAAA / GCAGTGAGTCCGTCCACATT / 200
Decreased
genes / CCL4 / CGCCTGCTGCTTTTCTTACA / TTCACTGGGATCAGCACAGAC / 142

Supplementary Table2. Significantly changed biological processes in FFI parietal lobescompared with the normal control from Clonetech (N-PL) and Korean samples.

PL-FFI vs. N-PL / PL-FFI vs. Korean sample
GO:0006350 transcription / GO:0006350 transcription
GO:0007165 signal transduction / GO:0008380 RNA splicing
GO:0006355 regulation of transcription, DNA-dependent / GO:0006355 regulation of transcription, DNA-dependent
GO:0008380 RNA splicing / GO:0006468 protein amino acid phosphorylation
GO:0022900 electron transport chain / GO:0007275 development
GO:0001666 response to hypoxia / GO:0022900 electron transport chain
GO:0007275 development / GO:0006120 mitochondrial electron transport, NADH to ubiquinone
GO:0006468 protein amino acid phosphorylation / GO:0000398 nuclear mRNA splicing, via spliceosome
GO:0007155 cell adhesion / GO:0006955 immune response
GO:0006120 mitochondrial electron transport, NADH to ubiquinone / GO:0006457 protein folding
GO:0006810 transport / GO:0001666 response to hypoxia
GO:0008285 negative regulation of cell proliferation / GO:0006810 transport
GO:0032313 regulation of Rab GTPase activity / GO:0051028 mRNA transport
GO:0006916 anti-apoptosis / GO:0009615 response to virus
GO:0007049 cell cycle / GO:0006397 mRNA processing
GO:0006457 protein folding / GO:0055114 oxidation reduction
GO:0002504 antigen processing and presentation of peptide or polysaccharide antigen via MHC class II / GO:0048861 leukemia inhibitory factor signaling pathway
GO:0000122 negative regulation of transcription from RNA polymerase II promoter / GO:0002504 antigen processing and presentation of peptide or polysaccharide antigen via MHC class II
GO:0006955 immune response / GO:0016584 nucleosome spacing
GO:0006811 ion transport / GO:0006338 chromatin remodeling

Theitalics represent the biological processes significantly changed compared with both the normal control of Clonetech and Korean samples.

Supplementary Table3.Significantly changed pathways in FFI parietal lobescompared with the normal control from Clonetech (N-PL) and Korean samples.

PL-FFI vs. N-PL / PL-FFI vs. Korean control
Parkinson's disease / Renal cell carcinoma
Alzheimer's disease / Parkinson's disease
Oxidative phosphorylation / Oxidative phosphorylation
Renal cell carcinoma / Alzheimer's disease
Focal adhesion / Focal adhesion
Regulation of actin cytoskeleton / Pancreatic cancer
Prostate cancer / VEGF signaling pathway
Apoptosis / MAPK signaling pathway
Acute myeloid leukemia / T cell receptor signaling pathway
Toll-like receptor signaling pathway / Regulation of actin cytoskeleton
T cell receptor signaling pathway / Axon guidance
MAPK signaling pathway / Cytokine-cytokine receptor interaction
Pancreatic cancer / Antigen processing and presentation
Endometrial cancer / Leukocyte transendothelial migration
Cytokine-cytokine receptor interaction / mTOR signaling pathway
Jak-STAT signaling pathway / Tight junction
Leukocyte transendothelial migration / Jak-STAT signaling pathway
B cell receptor signaling pathway / Melanoma
Chronic myeloid leukemia / Adherens junction
VEGF signaling pathway / ErbB signaling pathway

The italics represent the pathways significantly changed compared with both the normal control of Clonetech and Korean samples.