SUPPLEMENTAL DATA
Titels and legend to figures
Sup-Fig. 1. mRNA increases upon tet induction in HaCaT NHis-Gli2 cells in time course experiments.
NHis-Gli2 HaCaT cells were treated with tetracyclin (tet) for the times indicated. The levels of mRNA for Gli2, cFlip, Bcl-2 and Gli1 mRNA were determined by quantitative real-time RT-PCR simultaneously with huGAPDH as internal control for standardization. The relative level of mRNA was normalized to that at time 0, which was set to 1. Results represent the mean ± SD of three experiments.
Sup-Fig. 2. Gli2 binding sites are specific as mutations do not show binding.
A shifted band was detected when P32 radiolabeled double-stranded oligos for bs-bcl-2 was preincubated with nuclear extracts from tet-induced or uninduced NHis-Gli2 cells, and a super-shifted band appeared when specific anti-Gli2 antibody was added to the nuclear extracts. No shifted band nor supershifted band can be detected if mutated oligo was used. Data shown are representative of three different experiments.
Sup-Fig. 3. Gli2 gene silencing with specific siRNA decreased the expression of Bcl-2 or cFlip in BCC tissue.
BCC tissues were cut into small pieces. Each of them was transfected with Gli2-siRNA (siGli2) or control siRNA-GFP (siGFP) or without siRNA (Nil), and cultured for 3 days. Cryosections were made and stained to detect the expression of Gli2, cFlip and Bcl-2. Gli2-siRNA not only downregulated Gli2, but also cFlip and Bcl-2.
The results are representative of three different experiments (quantification see Figure 5b). Scale bars: 50µm.
Sup-Fig. 4. Selection and efficacy of siRNAs used.
Three human Gli2-specific 21-mer siRNA duplexes and one cFlip-siRNA were chemically synthesized by Qiagen, Switzerland. Both siRNA-GFP and a negative siRNA (siRNA-N) were also obtained from Qiagen. The synthesized sequences are
Gli2-siRNA-a (siRNA-G2a): 5’ cugac cucaa ggaag aucug g 3’
Gli2-siRNA-b (siRNA-G2b): 5’ cugag guggu caucu augag a 3’
Gli2-siRNA-c (siRNA-G2c): 5’ gagaa gaagg aguuu gugug c 3’
cFlip-siRNA: 5' ucuga ugugu ccuca uuaau u 3'
Screening of the potential Gli2 siRNAi
A 329-bp fragment (corresponding to Gli2 mRNA 600-928, NCBI Accession NM_030379) was amplified by RT-PCR with Gli2-specific primers (forward primer: 5’attca caagc gcagc aaggt c3’, reverse primer: 5’ tcccg cgtgc aggcc tgcc 3’), flanking the EcoR I or BamH I restriction sites added to facilitate cloning. After digestion and agarose gel purification, the fragment was cloned into the corresponding site of pEGFP-N1 (Clontech, California, USA) to generate the Gli2-GFP reporter vector, and confirmed by sequencing. Then, Hela cells cultured in 24-well plates were cotransfected with Gli2-GFP reporter plasmid (0.5 µg) and with or without each of the Gli2-siRNAs or control siRNAs (20 nM) in the presence of Lipofectamine 2000 (Invitrogen, Groningen, Netherland) according to the manufacturer’s protocol. Two days later, GFP-expressing cells were observed and photographed on a fluorescent microscope (a). To evaluate the activities of Gli2-siRNA duplexes GFP-expressing cells were counted, the mean counts ± SD of six different areas (of the same size) from three parallel wells are given (b). Gli2-siRNA-b was used for all further study, and its activity to silence Gli2 expression was confirmed with NHis-Gli2 HaCaT cells (c,d,e). The levels of Gli2 mRNA (c) or cFlip mRNA (d) or their protein (e) were determined as Figure 1. The results shown represent the mean ± SD of three experiments (c,d) or are representative of three different experiments (e).
Supplemental data ‘Materials and Methods’: Characterization and confirmation of Gli2 binding sites
Promoter reporter constructs and mutagenesis
Four putative cFlip promoter regions (pFlip Clusters I-IV, Table1) were predicted through in silico analysis according to the known Gli2 binding consensus sequence GACCACCCA, which was identified in all promoters of the published Gli2 targets including Gli1, FoxE1 and Bcl-2 (Eichberger et al., 2004; Ikram et al., 2004; Kinzler and Vogelstein, 1990; Regl et al., 2004b). Each candidate promoter was PCR amplified from genomic DNA of HaCaT cells and orientationally cloned upstream of the luciferase gene of a pGL3 basic vector (Promega). As a positive control, the Bcl-2 promoter fragment was also PCR amplified and cloned. Primers used were:
pFlip-If: 5' tatgctggtctctgactgggagct 3',
pFlip-Ir: 5' aaagaaaccgaaagcctggaagcgga 3',
pFlip-IIf: 5' tacattagatctctaccgcagctcctagtaggtg 3',
pFlip-IIr: 5' tacattagatcttcctctggaggctcaaggagac 3',
pFlip-IIIf: 5' tacattagatctcagtggcgcaatcttagc 3',
pFlip-IIIr: 5' tacattagatctgaggcaaggagttcaagac 3',
pFlip-IVf: 5' tacattagatcttttctgccctcaggtgtg 3',
pFlip-IVr: 5' tacattagatctgagggctgacttcatttc 3',
pBcl-2f: 5' ccacggactaggtgttcagg 3'
pBcl-2r: 5' atccttcccagaggaaaagc 3'.
Site-directed mutations (GACCAGGCG) of bs2 or/and bs3 were introduced into the pGL3-cFlip-II construct by PCR once or twice using paired primers containing mutated bases in their 5’ ends and Platinum pfx DNA polymerase with Enhancer Solution (Invitrogen) according to the manufacturer's protocol. After agarose gel purification, the PCR product was ligated and used to transform, and the mutations were confirmed by sequencing.
Promoter activity evaluation
At 2 days of co-transfection of HaCaT NHis-Gli2 cells or control cells with the candidate promoter reporter constructs and pEGFP-N1 (Clontech), both EGFP expression and the luciferase activity were measured with the Saphire II luminometer using the Luciferase Assay System (Promega) according to the manufacturer's protocol. Luminescence was normalized to EGFP expression and overall luciferase activity was calculated using the Microsoft Excel software.
Electrophoretic mobility shift assay (EMSA)
Nuclear and cytoplasmic protein extraction
HaCaT cells were trypsinized and washed with PBS, resuspended in 3x pellet volume of cold lysis buffer (0.1% Triton X-100, 1x CompleteTM Protease Inhibitor Cocktail, (Roche, Basel, Switzerland), 20mM HEPES, 75mM NaCl, 1mM DTT, 2 mM MgCl2), pipetted up and down 30 times on ice, and vortexed vigorously. The suspension was spun down at 800 x g in a centrifuge at 4°C. The supernatant, containing the cytoplasmic protein fraction, was transferred into a fresh tube for further study while the pellet was resuspended again in 3x pellet volume of lysis buffer, and KCl was slowly added to a final concentration of 300 mM. The mix was incubated on ice for 30 min and centrifuged for 15 min at 1600 x g at 4°C. The supernatant containing the nuclear protein fraction was transferred into a fresh tube for further use.
Probe preparation
All single stranded oligos for EMSA were synthesized by Microsynth (Microsynth, Switzerland). Sense strands were radiolabeled with P32 using polynucleotide kinase (New England Biolabs), and annealed to the antisense strands. The doubled strands were purified in a 4% polyacrylamide gel by excision. The radioactivities of probes were measured in a scintillator, and diluted to an activity of 5000 cpm/ml.
Gel shift assays
Nuclear extracts (10mg) from NHis-Gli2 were mixed with 2mg poly (dIdC), 2mg BSA and 2ml 10x EMSA buffer (20mM Hepes pH7.9, 75mM NaCl, 1mM DTT, 2mM MgCl2, 5% Glycerol), and the volume was adjusted with distilled water to 20ml. For supershift analysis, 1mg antibody was added and preincubated with the extracts first. For detection of free oligos, nuclear extracts were replaced by an equal volume of distilled water. The reaction mix was incubated for 30 min at RT, then 1 ml of radiolabeled probe was added and incubated again for another 30 min at RT. After incubation, samples were chilled on ice and separated on native 4% polyacrylamide gels. Following electrophoresis, gels were dried, exposed overnight, and scanned with a Molecular Imager® FX (Bio-Rad).
Competition experiments
For competition, excess concentrations (100:1 or 400:1) of the unlabeled Gli2-binding oligo bscon as a competitor were preincubated for 30 min before the incubation with the different radioactive probes. All samples were analysed using the same conditions as above.
1