1
Taxonomic Appendix
The most recent monographic treatment of Leptasterias (Fisher 1930) proposed numerous species, subspecies and forms within the six-rayed subgenusHexasterias. However, more recent taxonomic usage has tended to follow the suggestion of Chia (1966), who applied the name L. hexactis to all six-rayed sea stars in the Puget Sound region. Molecular genetic analysis of over 1200 six-rayed Leptasterias collected from the intertidal and shallow subtidal zones throughout the range of the subgenus in North America from Shemya Is., AK (52o44.7′ N/ 174o 7.0′ E) to San Simeon, CA (35o38.4′ N/ 121o12.0′ W) by PCR-RFLP survey of the mitochondrial DNA putative control region and flanking sequences (Foltz 1998) and sequencing (Hrincevich et al. 2000, Flowers and Foltz 2001) identified five molecular lineages that corresponded to five species or species complexes: L. aequalis, L. alaskensis, L. aleutica/L. camtschatica, L. hexactis and L. leptodoma. Three species complexes (L. aequalis, L. aleutica/L. camtschatica and L. hexactis) each showed genetic (allozymic, DNA sequence) and morphological heterogeneity suggestive of specific or subspecific differentiation (Table 2). Although an extended taxonomic treatment of these three complexes is beyond the scope of the present paper, two sympatrically distributed sister groups (L. aleutica/L. camtschatica, L. aequalis A/L. aequalis D) show genetic and morphological differences and likely correspond to conventional species under morphological, phylogenetic and/or genealogical concordance criteria for species delimitation. Two other sister groups (L. hexactis C/L. hexactis G, L. aequalis B/L. aequalis K) also show genetic and morphological differences, but because they are parapatrically distributed along the North American Pacific Coast (Table 2), determining their specific or subspecific status is problematic (e.g., Avise 2000). L. hexactis Cand L. aequalis Beach show micro-geographic (< 20 km scale) morphological variation in the Puget Sound region (Foltz and Flowers 2007), including variation in characters used by Fisher (1930) in his taxonomic revision of the genus. Some of this morphological variation is associated with environmental variation (protected versus exposed coastline), and thus could represent adaptive differences produced and maintained either by phenotypic plasticity or by natural selection. The morphological differences observed between sister groups L. hexactis C/L. hexactis G and L. aequalis B/L. aequalis K (primarily marked differences in the average number of actinal spines per ray, see Table 2) might represent similar morphological variation on a broader geographical scale. However, for L. hexactis C and L. hexactis G there is independent genetic evidence that the two lineages have been separated for a long period. In particular, the two lineages show allozyme differences averaged over 14 loci (Hrincevich and Foltz 1996) that are slightly greater than observed between L. aequalis A and L. aequalis B, a pair of sympatric non-sister species that are reproductively isolated as well as morphologically distinct (Foltz 1997, Foltz and Flowers 2007).
Figure S1. Approximate ranges along the Pacific coast of North America, from Attu Island, Alaska to San Simeon, California, of four pairs of putative sister species considered in the present study. Distributional data are based on molecular data from Foltz et al. (1996a, 1996b), Foltz (1998) and Flowers and Foltz (2001), rather than taken from Fisher (1930). L. hexactis C, L. aequalis A and L. aequalis B are sympatric in the Puget Sound Region.
Table S1 Effects of specimen age (range 128 years), preservation method (alcoholpreserved, fresh or formalinpreserved tissue) and size of target region(range 2501000 bp) on PCR amplification success for nuclear intron sequences. The amplification success rate from alcohol or formalinpreserved museum specimens was 80% for target regions of approximately 250 bp. Success rates declined for target regions of 1000 bp (alcoholpreserved specimens) and for regions of 5001000 bp (formalinpreserved specimens).
Sourceadeg. freedomType III Sum of SquaresMean Square Fvalue
Age of specimen20.790.393.09
Preservation method217.298.6567.25***
Size of target region111.2411.2487.45***
***P<0.001 [adjusted for multiple tests]
aAge (range 128 years) and preservation method were class variables and size was analyzed as a regressor variable, using PROC GLM in SAS v. 9.1.3.
Table S2. Models and parameter estimates from MrBayes for four data partitions, as well as various summary statistics for each partition. The tree length was 1.1612.
parameter/model / 1. EF-1 αb / 2. ATP synthase βc / 3. COI / 4. control regiondmodel / GTR+I / GTR+G / GTR+I+G / GTR+I+G
rAC / 0.1980 / 0.1622 / 0.1225 / 0.0847
rAG / 0.2681 / 0.2889 / 0.2390 / 0.3456
rAT / 0.1454 / 0.0952 / 0.0903 / 0.0291
rCG / 0.1044 / 0.1050 / 0.0131 / 0.1996
rCT / 0.1708 / 0.2488 / 0.5138 / 0.2837
rGT / 0.1133 / 0.0999 / 0.0213 / 0.0574
piA / 0.3029 / 0.3094 / 0.2594 / 0.3253
piC / 0.1781 / 0.1627 / 0.2249 / 0.1452
piG / 0.1927 / 0.1630 / 0.1711 / 0.1547
piT / 0.3263 / 0.3648 / 0.3447 / 0.3747
α shape parameter / -- / 3.0626 / 0.8997 / 0.6102
prop. inv. sites [I] / 0.5547 / -- / 0.4946 / 0.3453
rate multiplier / 0.5993 / 0.4240 / 1.2490 / 1.9329
G-test for molecular clock / 9.35, 24 degrees of freedom, P>0.05 / Not included in analysis / 26.71, 32 deg. of freedom, P>0.05 / 56.56, 48 deg. of freedom, P>0.05
Included in Fig. 1 / Yes / Yes / Yes / Yes
Included in BEAST analysis / Yes / No / Yes / Yes
Included in IMa analysis / Yes / No / No / Yes
Length as analyzed in Fig. 1 / 839 / 757 / 1074 / 556
Mean length in bp excluding missing dataa / 701.09 + 26.56 / 578.97 + 27.56 / 937.97 + 52.21 / 542.65 + 1.63
Range in bp / 259C835 / 206C754 / 125C1074 / 509C549
Mean length in bp including missing dataa / 593.23 + 46.76 / 549.28 + 33.34 / 697.46 + 76.86 / 514.82 + 19.48
Length as analyzed in Figs. 2-4e / 226 bp / Not included in analysis / 571 bp / 549 bp
aMean values are shown with standard errors. "Missing data" refer to gene regions that have a sequence length of zero for one or more taxa.In descending order of importance, missing data were due to [1] a lack of sequence information for one gene region, mostly COI, in 20 specimens, [2] ragged ends at the 5' or 3' end of some regions and [3] alignment gaps in each gene region except COI. In addition, the following regions of the Elongation factor-1 α subunit intron that totaled 351 bp were completely excluded from the analysis: the two internal priming sites (Internal-2F and -3F) and two poorly-aligned regions. Previous analyses of simulated DNA sequence data (Wiens 2003) suggest that phylogenetic accuracy is only slightly affected with 27% average missing data, and that the most likely effect of missing data is to exacerbate long-branch attraction problems. In the present analysis, long branches were restricted to the outgroup taxa, which were included only to test the monophyly of the genus Leptasterias.
bBecause of the relatively large size (approximately 1 kb) of the Elongation factor-1 α subunit intron 4 amplicon in Leptasterias, DNA from formalin-fixed or other poorly-preserved specimens was amplified in three abutting segments by using two internal primers and their reverse complements, in addition to the flanking primers described by Foltz et al. (2007b):
Internal-2F5=TGTGTGCATACATGTGGGTTAGTAAAGAAACTT
Internal-3F5=AATACATAAACCTCTTTGGTCAAATGCTCAACTTTAATA
cThe two ATP synthase β subunit introns share a 140-bp repeat sequence that evolves at a slow rate compared to flanking non-repetitive sequence and that also shows evidence for gene conversion. As a result, both copies of this repeat region were excluded from some of the analyses.
dPlus flanking tRNA and rRNA regions. The unassigned region in sea star mitochondrial DNA is called the putative control region, by analogy to the unassigned region in sea urchin mitochondrial DNA, which has been shown by experimental evidence to harbor a replication origin (Mayhook et al. 1992).
eExclusion of the outgroup taxa resulted in a shorter alignment for the putative control region and flanking sequences for these analyses (Table S3), due to the removal of gap-only sites. Also, the cytochrome oxidase subunit I and elongation factor-1 α subunit intron 4 alignments used were trimmed in length compared to those used in the phylogenetic reconstruction, due to missing data in some taxa.
Table S3. Details of IMa analysis.
Mutation model / HKY / HKY
Number of chains / 5 / 5
Number of chain swaps attempts per step / 6 / 6
Maximum time of population splitting / 2.5 / 3.5
Maximum migration rate between populations / 1 / 1
Maximum theta=4Nu / 10 / 10
Generation time in years / 1 / 1
Burn-in period (no. of steps) / 2500000 / 2500000
Number of trees to save / 250000 / 250000
Mutation rate per locus per year for Ef-1α (range) / 0.0000007 (0.0000001-0.0000013) / 0.0000007 (0.0000001-0.0000013)
Length of Ef-1α sequence / 226 bp / 226 bp
Mutation rate per locus per year for control region (range) / 0.000006 (0.000001-0.000012) / 0.000006 (0.000001-0.000012)
Length of control region and flanking sequences / 549 bp / 549 bp
Mean # migrants per 1000 generations per year from species 1 to species 2 (rangea) / 0.0009 (0-0.0020) / 0.0008 (0-0.0019)
Mean # migrants per 1000 generations per year from species 2 to species 1 (rangea) / 0.0009 (0-0.0020) / 0.0009 (0-0.0020)
4Ne for species 1b (rangea) / 3.2 (0.68-9.2) / 5.7 (0.17-11.4)
4Ne for species 2b (rangea) / 5.6 (1.10-11.6) / 8.1 (3.12-12.0)
aupper and lower 95% interval
bin units of 105 individuals
1
Table S4. Catalog numbers, collection details and GenBank accession numbers for specimens included in Figs. 2-4.
# / Species / Specimen voucher catalog number / Location / Date collected / Cytochrome oxidase subunit I / control region & flanking / ATP synthase β intron 5 / ATP synthase β intron 7 / Elongation factor-1 α intron 41 / Evasterias retifera / CASIZ 112462 / Attu Is., AK / August 1994 / EF134919 / EF134842 / EF134781 / EF134729
2 / Leptasterias aequalis A / USNM 1097830 / Sares Head, WA / June 2003 / EF134939 / EF134874 / EF134810 / EF134748
3 / Leptasterias aequalis A / USNM 1097792 / Friday Harbor, WA / June 2003 / EF134940 / EF134875 / EF134811 / EF134767
4 / Leptasterias aequalis A / LSUMNS I279 / Middle Cove, OR / 2 July 1992 / AF162089* / AF162111* / EF134749
5 / Leptasterias aequalis B / Balance Rock, BC / 29 August 1992 / EF134913 / EF555665 / EF134813 / EF134775
6 / Leptasterias aequalis B / LSUMNS I280 / False Bay, WA / 30 May 1988 / AF162090* / U37563* / EF134876 / EF134812 / EF134768
7 / Leptasterias aequalis B / CASIZ 115490 / San Luis Obispo Co., CA / 22 June 1978 / EF134910 / EF134856 / EF134792 / EF134739
8 / Leptasterias aequalis B / CASIZ 115496 / 6 km N San Simeon, CA / 21 June 1978 / EF134907 / EF134921 / EF134853 / EF134790 / EF134736
9 / Leptasterias aequalis B / CASIZ 115485 / 6 km N San Simeon, CA / 21 June 1978 / EF134908 / EF134922 / EF134854 / EF134791 / EF134737
10 / Leptasterias alaskensis / CASIZ 171750 / Unalaska Is., AK / 5 August 1997 / DQ077919* / EF134880 / EF134819 / EF134754
11 / Leptasterias alaskensis / LSUMNS I284, CASIZ 173117 / Homer, AK / 18 June 1993 / AF162094* / AF162114* / EF134882 / EF134821 / EF134755
12 / Leptasterias sp. / LSUMNS I292, LACM997195.001 / Amchitka Is., AK / 18 August 1997 / AF162102* / AF162121* / EF134828 / EF134761
13 / Leptasterias camtschatica / LSUMNS I294, USNM E51419 / Kiska Is., AK / 15 August 1997 / AF162104* / AF162123* / EF134858 / EF134793
14 / Leptasterias aleutica / LSUMNS I297, CASIZ 166538 / Unalaska Is., AK / 5 August 1997 / AF162107* / AF162126* / EF134831 / EF134764
15 / Leptasterias aleutica / LSUMNS I295 / Kiska Is., AK / 15 August 1997 / AF162105* / AF162124* / EF134829 / EF134762
16 / Leptasterias fisheri / CASIZ 150448# / Aleutian Is., AK / 19 June 2000 / EF134905 / EF134918 / EF134840 / EF134780 / EF134728
17 / Leptasterias fisheri / CASIZ 143741# / Aleutian Is., AK / 19 June 2000 / EF134904 / EF134917 / EF134839 / EF134779 / EF134727
18 / Leptasterias fisheri / CASIZ 143739# / Aleutian Is., AK / 21 June 2000 / EF134903 / EF134916 / EF134838 / EF134778 / EF134726
19 / Leptasterias hexactis C / LSUMNS I281, CASIZ 173116 / False Bay, WA / 30 May 1988 / AF162091* / U37564* / EF134878 / EF134815 / EF134751
20 / Leptasterias hexactis G / LSUMNS I285 / Balance Rock, BC / 29 August 1992 / AF162095* / AF162115* / EF134822 / EF134756
21 / Leptasterias aequalis K / LSUMNS I299, CASIZ 173118 / Pigeon Pt., CA / 13 June 1998 / AF162109* / AF162128* / EF134832
22 / Leptasterias aequalis K / CASIZ 115500 / 6 km N San Simeon, CA / 21 June 1978 / EF134906 / EF134920 / EF134852 / EF134789 / EF134735
23 / Leptasterias aequalis K / LSUMNS I290, LACM 1995165.1 / Asilomar, CA / 2 February 1995 / AF162100* / AF162119* / EF134885 / EF134825
24 / Leptasterias aequalis K / LSUMNS I289 / San Simeon, CA / 28 June 1991 / AF162099* / AF162118* / EF134763
25 / Leptasterias leptodoma / USNM E51426 / Kiska Is., AK / 15 August 1997 / EF134929 / EF134864 / EF134799 / EF134745
26 / Leptasterias leptodoma / USNM E51421 / Kiska Is., AK / 15 August 1997 / EF134930 / EF134865 / EF134800 / EF134746
27 / Leptasterias leptodoma / USNM E51427 / Kiska Is., AK / 15 August 1997 / EF134927 / EF134862 / EF134797 / EF134743
28 / Leptasterias leptodoma / USNM E51420 / Kiska Is., AK / 15 August 1997 / EF134926 / EF134861 / EF134796 / EF134742
29 / Leptasterias leptodoma / USNM E51425 / Kiska Is., AK / 15 August 1997 / EF134928 / EF134863 / EF134798 / EF134744
30 / Leptasterias muelleri / LSUMNS I306 / Hvassahraun, Iceland / AF199435* / AF199434* / EF134879 / EF134818 / EF134753
31 / Leptasterias polaris / Juneau, AK / 21 Sept. 1990 / EF134924 / EF134859 / EF134794 / EF134740
32 / Leptasterias polaris / Juneau, AK / 21 Sept. 1990 / EF134925 / EF134860 / EF134795 / EF134741
33 / Leptasterias aequalis D / LSUMNS I282, CASIZ 166537 / Sekiu, WA / 24 July 1991 / AF162092* / AF162112* / EF134816 / EF134752
34 / Leptasterias aequalis D / CASIZ 115497 / 6 km N San Simeon, CA / 21 June 1978 / EF134909 / EF134923 / EF134855 / EF555667 / EF134765
35 / Leptasterias stolacantha / CASIZ 137894# / Aleutian Is., AK / 13 June 2000 / EF134902 / EF134915 / EF134837 / EF134777 / EF134725
36 / Leptasterias stolacantha / CASIZ 137863# / Aleutian Is., AK / 12 June 2000 / EF134901 / EF134914 / EF134836 / EF134776 / EF134724
Pisaster ochraceus / AF217388*/ NC004610* / X16887*/ M25320*
Pisaster brevispinus / CASIZ 108886 / Pillar Pt., CA / 6 February 1997 / EF134888
Pisaster giganteus / CASIZ 116600 / Pillar Pt., CA / 6 February 1997 / EF134833
Stephanasterias albula / CASIZ 137842 / Aleutian Is., AK / 11 June 2000 / DQ077932* / EF134889 / EF134834
Stephanasterias albula / CASIZ 137887# / Aleutian Is., AK / 11 June 2000 / EF134944
Urasterias lincki / LSUMNS I305,
USNM E51645 / White Sea, Russia / July 1999 / AF190507*
Urasterias lincki / LACM 1999-141.9 / White Sea, Russia / July 1999 / DQ077934* / EF134835
#Cataloged and identified as Leptasterias sp.
*Previously-published sequences obtained from GenBank
1
Table S5. Catalog numbers, collection details and GenBank accession numbers for specimens included in Figs. 2-4 and Table 2.
# / Species / Specimen voucher catalog number / Location / Date collected / Cytochrome oxidase subunit I / control region & flanking / ATP synthase β intron 5 / ATP synthase β intron 7 / Elongation factor-1α intron 437 / L. aequalis A / USNM 1097816 / Friday Harbor, WA / June 2003 / EF134934 / EF555668
38 / L. aequalis A / USNM 1097814 / Friday Harbor, WA / June 2003 / EF134935 / EF134869 / EF134804
39 / L. aequalis A / USNM 1097780 / Puget Sound, WA / June 2003 / EF134912 / EF134872 / EF134808
40 / L. aequalis A / USNM 1097793 / Friday Harbor, WA / June 2003 / EF134941 / EF134817 / EF134774
41 / L. aequalis A / USNM 1097829 / Sares Head, WA / June 2003 / EF134943 / EF134887 / EF134830
42 / L. aequalis A / Anacortes, WA / 22 July 1991 / EU143725 / EU143728
43 / L. aequalis A / Middle Cove, OR / 2 July 1992 / EU143729
44 / L. aequalis B / MitchellBay, WA / 1992 / EF134932 / EF134867 / EF134802
45 / L. aequalis B / Balance Rock, BC / 29 Aug. 1992 / EF555647 / EF555664
46 / L. aequalis B / Balance Rock, BC / 29 Aug. 1992 / EF555646 / EF555663
47 / L. aequalis B / RBCM 995-18-1 / False Bay, WA / 30 May 1988 / EU143723
48 / L. aequalis B / LSUMNS I304 / Balance Rock, BC / 29 Aug. 1992 / AF190503* / AF190506* / EF134890 / EF134807 / EF134766
49 / L. aequalis K / CASIZ 115514 / 6 km N of San Simeon, CA / 21 June 1978 / EF134738
50 / L. aequalis K / USNM E51583 / Pigeon Pt., CA / 13 June 1998 / EU143724 / EU143734
51 / L. aequalis K / Doran Rocks, CA / 29 June 1991 / EU143733
52 / L. alaskensis / Little Port Walter, AK / 10 June 1994 / EU143727
53 / L. aleutica / LSUMNS I287 / Amchitka Is., AK / 18 Aug. 1997 / AF162097* / AF162116*
54 / L. camtschatica / LSUMNS I296 / Kiska Island, AK / 15 Aug. 1997 / AF162106* / AF162125*
55 / L. camtschatica / LSUMNS I291 / Amchitka Is., AK / 18 Aug. 1997 / AF162101* / AF162120*
56 / L. camtschatica / LSUMNS I298 / Amchitka Is., AK / 18 Aug. 1997 / AF162108* / AF162127*
57 / L. hexactis C / USNM 1097809 / MitchellBay, WA / June 2003 / EF134931 / EF134866 / EF134801
58 / L. hexactis C / USNM 1097787 / False Bay, WA / June 2003 / EF134933 / EF134868 / EF134803
59 / L. hexactis C / USNM 1097757 / False Bay, WA / June 2003 / EF134936 / EF134870 / EF134805
60 / L. hexactis C / USNM 1097836 / MitchellBay, WA / June 2003 / EF134937 / EF134871 / EF134806
61 / L. hexactis C / RBCM 995-75-3 / Kodiak Is., AK / 19 June 1993 / EF134884 / EF134824 / EF134758
62 / L. hexactis C / USNM 1097841 / MitchellBay, WA / June 2003 / EF555652
63 / L. hexactis G / RBCM 995-77-2 / Cordova, AK / 17 June 1993 / EF134873 / EF134809 / EF134747
64 / L. hexactis G / RBCM 995-77-1 / Cordova, AK / 17 June 1993 / EF134877 / EF134814 / EF134750
65 / L. hexactis G / RBCM 995-74-3 / Homer, AK / 18 June 1993 / EF134883 / EF134823 / EF134757
66 / L. hexactis G / Little Port Walter, AK / 10 June 1994 / EF555648 / EF555661
67 / L. hexactis G / Little Port Walter, AK / 10 June 1994 / EF555649 / EF555662
68 / L. hexactis G / Homer, AK / 18 June 1993 / EU143732
69 / L. leptodoma / USNM E51424 / Kiska Is., AK / 15 Aug. 1997 / DQ077921* / EF134881 / EF134820
70 / L. leptodoma / RBCM 995-79-7 / Amchitka Is., AK / 23 June 1993 / EU143726
71 / L. leptodoma / CASIZ 173115 / Kiska Island, AK / 15 Aug. 1997 / AF162098* / AF162117*
72 / L. muelleri / Hvassahraun, Iceland / EF555666 / EF616506
73 / L. polaris / Juneau, AK / 21 Sept. 1990 / DQ077924* / EF134886 / EF134826 / EF134759
74 / L.aequalis D / Doran Rocks, CA / 29 June 1991 / EU143731
75 / L.aequalis D / RBCM 995-20-1 / Sekiu, WA / 24 July 1991 / EU143730
*Previously-published sequences obtained from GenBank
Supplemental References
Chia FS (1966) Systematics of the six-rayed sea star, Leptasterias, in the vicinity of San Juan Island, Washington. Syst Zool 15:300-306
Foltz DW (1997) Hybridization frequency is negatively correlated with divergence time of mitochondrial DNA haplotypes in a sea star (Leptasterias spp.) species complex. Evolution 51:283-288
Foltz DW (1998) Distribution of intertidal Leptasterias along the Pacific North American coast: a synthesis of allozymic and mtDNA data. In: Mooi R, Telford M (eds) Proc 9th Int Echin Conf, Balkema, Rotterdam, pp 235239
Mayhook AG, Rinaldi AM, Jacobs HT (1992) Replication origins and pause sites in sea urchin mitochondrial DNA. Proc R Soc Lond 248B:85-94
Wiens JJ (2003) Missing data, incomplete taxa, and phylogenetic accuracy. Syst Biol 52:528-538