Real-Time Quantitative PCR and Western Blot Analysis

Electronic Supplementary Material

ESM-Methods

Real-time quantitative PCR and western blot analysis

We used the TrizolTM reagent (Invitrogen, USA) and followed the manufacturer’s instructions to isolate total RNA [1]. The purity and concentration of each RNA sample was estimated using the Nanodrop 2000/2000C (Thermo Scientific). Approximately 1 μg of total RNA from each sample was used to generate first-stand cDNA using an oligo-dT (15) primer (Promega) and M-MLV reverse transcriptase (Promega) according to the manufacturer's protocol.Fluorescent real-time quantitative PCR was performed in a 10-μL total reaction volume comprising 5 μL of a premix (BIO-RAD, SsoFast TMEvaGreen®Supermix), 0.5 μL of each primer (2 μM) for quail or 1 μL of each primer (2 μM) for other species, 1 μL of cDNA template, and water. PCR was conducted using a Mx3000P detection system (Stratagene) and the parameters were as follows: 30 s at 95°C, followed by 35 cycles of 10 s at 95 °C, 10 s at 60 °C, and 25 s at 72 °C (for P. sinensis); or 32 cycles of 10 s at 95 °C, 10 s at 59 °C, and 25 s at 72 °C (for T. septentrionalis); or 35 cycles of 10 s at 95 °C, 10 s at 60 °ºC,and 5 s at 72 °C (for C. coturnix); or 35 cycles of 10 s at 95 °C, 10 s at 57 °C, and 20 s at 72 °C (for A. platyrhynchos). A melting curve of products was performed after amplification to exclude non-specific products by one cycle of 30 s at 95 °C, 30 s at 65 °C, and 30 s at 95 °C. Each reaction was performed in triplicate and normalized using β-actin. The specific primers used in the PCR reaction are shown in Table S1.

Table S1. Primer sequences used in real-time quantitative PCR

Species / Gene / Primer sequence (5ˊ→3ˊ) / accession No.
Takydromus
Septentrionalis / β-actin / TGAACCCCAAAGCCAACAGA GGGCGTAGCCTTCGTAGATG / Designed according to the conserved domain of other species
hsp70 / GCAAGGAACTCAACAAAAGCA CTCGATCCCCAGCGACAG / Designed according to the conserved domain of other species
Pelodiscus
sinensis / β-actin / CGCTCGTCGTTGATAATGG TTCAGGGTCAGGATACCTCTTT / AY998617.1
hsp70 / GCTCAACGCCGACCTCTT CGCCCACCAGCACAATCTC / JF694990.1
Coturnix coturnix / β-actin / CCAATGCCATCCTGCGTC TCTCGGCTGTGGTGGTGAA / AF199488.1
hsp70 / CCCACGGCTGCTGCTATT CGCCTCACTGCTCGCTTA / EU622852.1
Anas platyrhynchos / β-actin / ATCTTTCTTGGGTATGGAGTC GAAGCATTTGCGGTGG / EF667345.1
hsp70 / GGATGATAAACTGAAGGGAAAG AAGCAAAGAATGGATTGACTGT / EU678246.2

Livers were homogenized in ice-cold buffer [40 mM Tris (pH 7.5), 1 mM PMSF, 1 mM EDTA] to extract total protein. The homogenates were centrifuged at 10,000g for 15 min at 4°C and protein concentrations in the supernatants were measured using a Nanodrop 2000/2000C (Thermo Scientific). Western blot analysis was performed according to the procedure reported by Huang and Kang [2], with some modifications. Samples were boiled for 10 min with a loading buffer (5:1) containing sodium dodecyl sulfate (10%), β-mercaptoethanol (5%), bromophenol blue (0.5%), Tris (0.25 M, pH 6.8), and glycerin (50%). For each species, equal amounts of proteins were loaded onto a 10% SDS-PAGE gel, together with a protein molecularweight ladder (PageRuler Pre-stained protein ladders, Thermo Scientific, 26619). After electrophoresis at 90V for 2 h, one gel was stained with Coomassie Blue and the others transferred onto a nitrocellulose membrane using a Semi-Dry cell (JUNYI). The gel subjected to Coomassie Blue was stained by 0.5% G250 in 10% ethanoic acid and 40% methanol. After staining, the gel was washed with destaining solution (30% methanol and 10% ethanoic acid) and then photographed. The total protein content was quantified as the main band intensity using the image analysis software (Quantity One, Bio-Rad).For the electroblotted one,membranewas blocked with 3% skim milk for 1 h and incubated overnight with primary anti-HSP70 monoclonal antibody (BD; 610607 for birds and lizard, antibody prepared in our lab for the turtle samples) at a dilution of 1:2,000. After washing in TBST buffer (10 mM Tris, 0.87% NaCl, 0.05% Tween-20, pH 7.5), horseradish peroxidase-conjugated anti-mouse IgG (Kang Wei, CW0102 for birds and lizards) or horseradish peroxidase-conjugated anti-rabbit IgG (KPL, 14-16-06 for turtles) were added ata dilution of 1:5,000. Then the membrane was washed with TBST again and the bound antibody was detected using a solution consisting of 6 μL of 30% H2O2, 9 mL TBS, and 6 mg 4-chloro-1 naphthol in methanol. The membrane was scanned and stored. HSP70 protein levels were quantified as the band intensity as described above.

References:

1.Krivoruchko, A., Storey, K.B. 2010 Regulation of the heat shock response under anoxia in the turtle, Trachemys scripta elegans. J CompPhysiol B180, 403-414.

2.Huang, L.-H., Kang, L. 2007 Cloning and interspecific altered expression of heat shock protein genes in two leafminer species in response to thermal stress. Ins Mol Biol16, 491-500.

Fig. S1. Detection of the plasmidsand the expression ofPsHSP70 inthe hatchlings of Pelodiscus sinensis. (A).hsp70 gene expression.Hatchlings from eggs injected with pIRESPsHsp70 (lane1) or pIRES2-EGFP (lane 2 and 3) were used. (a) Extracted DNA was used for PCR with primers specific for pIRESPsHsp70 (lane 1 and 2) or specific for pIRES2-EGFP (lane 3); (b) Extracted RNA was used for PCR with the primers described in (a); (c) Extracted RNA was used for PCR with primers specific to β-actin (internal control).(B). Distribution and expression ofplasmids. Hatchlings from eggs injected with either PBS (a, b, c), pIRES2-EGFP (d, e, f) or pIRESPsHsp70 (g, h, i)were fixed and observed under fluorescence microscope for DAPI nuclear staining (a, d, g) with an exposure time of 20 ms or green fluorescence with an exposure time of 200 ms (b, e, h).(C). HSP70 expression in hatchlings from eggs injected with PBS, pIRES2-EGFP or pIRESPsHsp70. The loading amounts of total protein were all 400 μg. HSP70 expression was quantified as the quotient between HSP70band intensitiesand total protein intensities(the loading control of Coomassie Blue staining, LC) in each lane. Bands of LC were shown above the western blots. Data are shown as means ± SE (n = 3 for each treatment). Means with different letters above the error bars are statistically different (Tukey’s post-hoc test).The level of HSP70 was significantly higher in hatchlings from eggs injected with pIRESPsHsp70 than those from eggs injected with pIRES2-EGFP or PBS (F2,6=227.9, P < 0.0001).

Fig. S2. The hatching success of Pelodiscus sinensis embryos from different HSP70 expression treatments.The eggs from HSP70 overexpression treatments were injected with pIRESPsHsp70, while those from shame control with pIRES2-EGFP. Statistical significance between groups was calculated by X2 test (***, P < 0.001). Numbers above the error bars are sample size.

Fig.S3. The influence of HSP70 overexpression during embryogenesison body size (A), swimming performance (B), and specific growth rate (C) of Pelodiscus sinensis hatchlings. The eggs from HSP70 overexpression treatments were injected with 10 μg of plasmid pIRES2-EGFP cloned with turtle hsp70 sequences. The specific growth rate (SGR) was calculated as SGR =(lnWt − lnWo)/T × 100%, in which Wo= initial body mass; Wt = final body mass; and T = duration of experiment.Data are shown as means  SE. Numbers above the error bars are sample size in the bottom graph and are applicable to the upper graphs of this figure.

1