Mac protein is not an essential virulence factor for the virulent reference strain Streptococcus suis P1/7---- Current Microbiology
Genhui Xiao 1, 2, 3, Zongfu Wu1, 2, 3, Shouming Zhang1, 2, 3, Huanyu Tang1, 2, 3,
Fengqiu Wang1, 2, 3, Chengping Lu1, 2, 3#
# Corresponding Author: Chengping Lu, Ph.D
Tel/Fax:0086-25-84396517 Email:
Supplementary Table S1. Characteristics of various S. suis strains used for homology analysis in this study
Strain / Serotype / Characteristics / ReferenceBM407 / 2 / Virulent, isolate from a patient with meningitis / [1]
05ZYH33 / 2 / Virulent, isolate from a patient with TSLS / [2]
98HAH33 / 2 / Virulent, isolate from a patient with TSLS / [2]
GZ1 / 2 / Virulent, isolate from a patient with meningitis / [3]
SC84 / 2 / Virulent, isolate from a patient with TSLS / [4]
P1/7 / 2 / Virulent, isolate from a disease pig with meningitis / [1]
A7 / 2 / Intermediately virulent, isolate from a disease pig with meningitis / [5]
S735 / 2 / Weakly virulent , isolate from a disease pig with pneumonia / [6-8]
SC070731 / 2 / Virulent, isolate from a disease pig with meningitis / [9]
10 / 2 / Virulent, isolate from a disease pig / [7]
ZY05719 / 2 / Virulent, isolate from a disease pig / [10]
SS2-1 / 2 / Virulent, isolate from a disease pig / [11]
HA9801 / 2 / Virulent, isolate from a disease pig / [12, 13]
T15 / 2 / Avirulent, isolate from a healthy pig / [14]
05HAS68 / 2 / Avirulent, isolate from a clinically healthy pig / [15]
HA0608 / 2 / Isolate from a disease pig / collected in our laboratory
ZZJS0908005 / 2 / Isolate from a disease pig / collected in our laboratory
LS091105 / 2 / Isolate from a disease pig / collected in our laboratory
HZ060601 / 2 / Isolate from a disease pig / collected in our laboratory
HN004001 / 2 / Isolate from a disease pig / collected in our laboratory
SS12 / 1/2 / Isolate from a disease pig with pneumonia / [5]
ST1 / 1 / Isolate from a disease pig / [5]
ST3 / 3 / Isolate from a disease pig with pneumonia / [16]
YB51 / 3 / Isolate from a healthy pig / [17]
6407 / 4 / Isolate from a disease pig / [18]
D9 / 7 / Virulent, isolate from a disease pig / [5]
D12 / 9 / Weakly virulent, isolate from a disease pig with pneumonia / [5]
GZ0565 / 9 / Virulent, isolate from a disease pig with meningitis / [19]
JS14 / 14 / Virulent , isolate from a disease pig with arthritis / [20]
TL13 / 16 / Isolate from a healthy pig / [21]
TSLS, toxic shock-like syndrome
Supplementary Table S2 Primers used for PCR amplification
Primer / Primer sequence(5'-3')a / Restriction site / Functionmac-A / CTGATCGTCGACAGTGAATGCAGCTGGTAAAGC / Sal I / Left arm of mac; amplifies flank sequence located in upstream of mac (703 bp)
mac-B / TAGAGGCAAAAAATCTATAACA
mac-C / TGTTATAGATTTTTTGCCTCTAGACTCTTGTTCTTGGTAGTGCT / Right arm of mac; amplifies flank sequence located in downstream of mac (701 bp)
mac-D / GAGTCAGGATCCTGAAGATGACATGGGCTACGAT / BamH I
mac-IN1 / GCAGACAACATCCCATCA / Fragment for mac ORF; used to confirm deletion of macb (754 bp)
mac-IN2 / ACCGCTCATAACTACCACTA
mac-X / TTGAGCAAGGTTTGAACTTTAT / Fragment for mac ORF; used to confirm deletion of macc and sequencing arms of mac
mac-Y / ATGTTCGACCACAAAAAGGACA
C-mac-F / CTGCGACTGCAGGAGAATAAGTTAAATACGTGCTG / PstI / Fragment for complementation of mac (3916 bp) and sequencing mac of 10 strains
C-mac-R / ATACGTGGATCCTACAATAAGCAACGGGGAACCTC / BamHI
a Restriction enzyme recognition sequences are underlined.
b The wild type will produce a 754 bp fragment by PCR, but the mutant strain will not.
c The wild type will produce a 5249 bp fragment by PCR, and the mutant will produce a 1797 bp fragment
References
1. Holden MT, Hauser H, Sanders M, Ngo TH, Cherevach I, Cronin A, Goodhead I, Mungall K, Quail MA, Price C et al: Rapid evolution of virulence and drug resistance in the emerging zoonotic pathogen Streptococcus suis. PloS one 2009, 4(7):e6072.
2. Chen C, Tang J, Dong W, Wang C, Feng Y, Wang J, Zheng F, Pan X, Liu D, Li M et al: A Glimpse of Streptococcal Toxic Shock Syndrome from Comparative Genomics of S.suis 2 Chinese Isolates. PloS one 2007, 2(3).
3. Ye C, Zheng H, Zhang J, Jing H, Wang L, Xiong Y, Wang W, Zhou Z, Sun Q, Luo X et al: Clinical, Experimental, and Genomic Differences between Intermediately Pathogenic, Highly Pathogenic, and Epidemic Streptococcus suis. Journal of Infectious Diseases 2009, 199(1):97-107.
4. Zheng H, Lan R, Zheng X, Cui Z, Liu Z, Bai X, Ji S, Gottschalk M, Xu J: Comparative Genomic Hybridization Identifies Virulence Differences in Streptococcus suis. PloS one 2014, 9(2).
5. Zhang A, Yang M, Hu P, Wu J, Chen B, Hua Y, Yu J, Chen H, Xiao J, Jin M: Comparative genomic analysis of Streptococcus suis reveals significant genomic diversity among different serotypes. BMC genomics 2011, 12.
6. Boyle B, Vaillancourt K, Bonifait L, Charette SJ, Gottschalk M, Grenier D: Genome sequence of the swine pathogen Streptococcus suis serotype 2 strain S735. J Bacteriol 2012, 194(22):6343-6344.
7. de Greeff A, Buys H, Wells JM, Smith HE: A naturally occurring nucleotide polymorphism in the orf2/folc promoter is associated with Streptococcus suis virulence. Bmc Microbiol 2014, 14.
8. Charland N, Harel J, Kobisch M, Lacasse S, Gottschalk M: Streptococcus suis serotype 2 mutants deficient in capsular expression. Microbiol-Uk 1998, 144:325-332.
9. Wu Z, Wang W, Tang M, Shao J, Dai C, Zhang W, Fan H, Yao H, Zong J, Chen D et al: Comparative genomic analysis shows that Streptococcus suis meningitis isolate SC070731 contains a unique 105 K genomic island. Gene 2014, 535(2):156-164.
10. Zhang W, Lu CP: Immunoproteomics of extracellular proteins of Chinese virulent strains of Streptococcus suis type 2. Proteomics 2007, 7(24):4468-4476.
11. Zhu H, Zhou J, Ni Y, Yu Z, Mao A, Hu Y, Wang W, Zhang X, Wen L, Li B et al: Contribution of eukaryotic-type serine/threonine kinase to stress response and virulence of Streptococcus suis. PloS one 2014, 9(3):e91971.
12. Zhao ZZ, Wang J, Liu PH, Zhang SH, Gong JP, Huang XQ, Li B, Xu FQ: Cultivation, LD50 determination and experimental model of Streptococcus suis serotype 2 strain HA9801. Res Vet Sci 2009, 86(2):200-205.
13. Chen T, Huang Q, Li ZL, Zhang W, Lu CP, Yao HC: Construction and Characterization of a Streptococcus suis Serotype 2 Recombinant Expressing Enhanced Green Fluorescent Protein. PloS one 2012, 7(7).
14. Vecht U, Arends JP, van der Molen EJ, van Leengoed LA: Differences in virulence between two strains of Streptococcus suis type II after experimentally induced infection of newborn germ-free pigs. Am J Vet Res 1989, 50(7):1037-1043.
15. Tang JQ: Analyses reveal a novel avirulent Streptococcus suis Serotype 2 strain that induces protective immunity against challenge with the highly virulent strains. Retrovirology 2010, 7:66-66.
16. Hu P, Yang M, Zhang A, Wu J, Chen B, Hua Y, Yu J, Chen H, Xiao J, Jin M: Complete genome sequence of Streptococcus suis serotype 3 strain ST3. J Bacteriol 2011, 193(13):3428-3429.
17. Wang K, Chen J, Yao H, Lu C: Whole-Genome Sequence of Streptococcus suis Serotype 3 Strain YB51. Genome announcements 2013, 1(6).
18. Wang K, Chen J, Yao H, Lu C: Whole-Genome Sequence of Streptococcus suis Serotype 4 Reference Strain 6407. Genome announcements 2014, 2(4).
19. Wu ZF, Zhang W, Lu CP: Comparative proteome analysis of secreted proteins of Streptococcus suis serotype 9 isolates from diseased and healthy pigs. Microbial Pathogenesis 2008, 45(3):159-166.
20. Hu P, Yang M, Zhang AD, Wu JY, Chen B, Hua YF, Yu J, Xiao JF, Jin ML: Complete Genome Sequence of Streptococcus suis Serotype 14 Strain JS14. Journal of bacteriology 2011, 193(9):2375-2376.
21. Wang K, Yao H, Lu C, Chen J: Complete Genome Sequence of Streptococcus suis Serotype 16 Strain TL13. Genome announcements 2013, 1(3).