A non-restricting and non-methylating Escherichia coli strain
for DNA cloning and high throughput conjugation to Streptomyces coelicolor
Supplementary materials
1. Supplementary Table S1 E. coli and Streptomyces strains and plasmids
2. Supplementary Table S2 Oligonucleotides
3. Supplementary Methods: Construction of Δdcm and ΔdcmΔdam mutants
4. Supplementary Fig. S1
5. Supplementary Fig. S2
6. Supplementary References
1. Supplementary Table S1 E. coli and Streptomyces strains and plasmids
Strains and plasmids / Genotype and phenotype* / ReferenceE. coli DH10B / F- mcrA Δ(mrr-hsdRMSmcrBC) recA1 endA1 λ- rpsL (StrR) nupG Δ(araA, leu)7697 araD139; non-methyl restricting / (3)
E. coli JTU006 / Δdcm::aadA derivative of DH10B; non-methyl restricting, Dcm- / This work
E. coli JTU007 / recA+ Δdam::neo (KmR) Δdcm::aadA (SpcR) derivative of DH10B; non-methyl restricting, non-methylating, recombination proficient / This work
E. coli ET12567 / dam13::Tn9 (CmR) dcm-6 hsdM hsdR recF143 rpsL (StrR); non-methylating / (10)
E. coli BW25113 / hsdR rrnB ΔlacZ ΔaraBAD ΔrhaBAD; origin of recA gene / (7)
S. coelicolor YF9 / Derivative of M145, actinorhodin biosynthesis cluster deleted (DSCO5073-SCO5095) / Yu, Yanfei, unpublished
S. coelicolor YF11 / Derivative of YF9, RedL partially deleted; no ACT- or RED- / Yu, Yanfei, unpublished
S. lividans TK24 / Plasmid free strain, contains the act gene cluster, but produces normally very little actinorhodin / (8)
S. toxytricini NRRL15443 / Producer of lipstatin and a brown pigment / (13)
pSET152 (5.7 kb) / oriTRK2 (origin of conjugal transfer) attP (fC31 attachment site) int (site-specific integrase) aac(3)IV (AprR) / (1, 2)
pMM1 (45 kb) / pSET152::act (39 kb S. coelicolor SCO5065-SCO5102; actinorhodin biosynthesis, regulation and resistance genes) / Wang, Yemin, unpublished
pUZ8002 (c. 60 kb) / KmR, TetR; RK2-derived, non-conjugative helper plasmid, used to mobilize pSET152 and pMM1 / (5)
pIJ790 (6.1 kb) / CmR; temperature sensitive replicon for E. coli, λ-RED recombination system, ara operon / (6)
pJTU6819 (9.5 kb) / CmR; The recA fragment into the NheI site of pIJ790 / This work
pIJ4642 / source of aadA (SpcR) / (8)
Supercos1 / source of neo (KmR) / (4)
pJTU2554 (9.5 kb) / pSET152 derivative containing three cos sites (AprR) / (9)
2. Supplementary Table S2 Oligonucleotides
Name / Sequence (lower case, 5’non-complementary tail) / PurposedcmaadAf / aacgttggtggcgcagcttaatggtgtaggtgagaatcactggagCCGCAGTTGCAAACCCTCA / Constructing Ddcm::aadA mutant JTU006
dcmaadAr / ggtccaacagctgcgccagcgtcactcgctgcgcagggaaacattAGTGCATCTAACGCTTGA
dcmout1 / ACGCATCAAGCGAGTAAATG / Confirming Ddcm::aadA mutation
dcmout4 / TTCTTCAATCCTGGCGGCAG
damneof / atactgtttcatccgcttctccttgagaattattttttcgcgggtgaaacgtggaatcgaaatctcgtga / Constructing Ddam::neo mutant JTU007
damneor / gtcggagctttctccacagccggagaaggtgtaattagttagtcagcatgcacgctgccgcaagcactca
damout1 / CCGCAAGCAACCGTGAAA / Confirming Ddam::neo mutation
damout4 / GAAAGACTGACCGCCGAAAC
recAf / cccaagcttactagtATAACCAGGCACCAACCAC / Constructing pJTU6819
recAr / cgggatccaagcttactagtTTGTCGAGCCCAAGGAACA
1
3. Supplementary Methods
Construction of Δdcm and ΔdcmΔdam mutants
The dcm and dam gene replacement experiments were carried out according to the REDIRECT® PCR-targeting method (6).
An internal 766 bp fragment of dcm was replaced using the REDIRECT® procedure and oligonucleotides dcmaadAf and dcmaadAr to amplify the pIJ4642 aadA with 45 bp tails matching the dcm sequence of DH10B. The resulting 1558 bp PCR fragment was transformed into arabinose-induced E. coli DH10B/pIJ790 competent cells by electroporation and incubated at 37 °C. The Ddcm::aadA gene replacement in SpcR progeny was confirmed by PCR using primers dcmout1 and dcmout4 and sequencing.
The replacement of dam in E. coli JTU006 was complicated because dam recA double mutants are not viable (12). The recA gene was PCR amplified from E. coli BW25113 so that it was located centrally on a 3.4 kb fragment (primers recAf and recAr) and cloned into the temperature sensitive plasmid pIJ790 to give pJTU6819. This plasmid was then introduced by transformation into E. coli JTU006 to provide a functional recA gene which had the possibility to replace the chromosomal mutant gene by double crossover recombination.
An 813 bp central region of dam was then replaced using REDIRECT® with the neo gene from Supercos1. The resulting gene replacement strain was confirmed by PCR using primers damout1 and damout4. One of the Ddcm::aadA Ddam::neo clones was transferred to 1 ml LB +Km, and incubated for 8 h at 40 °C to force integration of pJTU6819 into the chromosome by homologous recombination at recA. The culture was then diluted for single colonies and propagated at 40 °C on LB agar containing Km three times to ensure that the temperature sensitive pJTU6819 was lost, and the Ddam::neo mutations were retained. One clone was named JTU007. It was confirmed by PCR and sequencing to carry a wild type allele of recA in the chromosome.
4. Supplementary Fig. S1
Fig. S1 Confirmation of the Ddcm::aadA and Ddam::neo gene replacements. Ethidium bromide-stained 0.7% agarose gels. A. Replacement of dcm by aadA increased the size of the specific PCR fragment from 2.4 kb to 3.1 kb. Lane 1, DH10B; lane 2, JTU006 (Ddcm::aadA); lane 3, JTU007 (Ddcm::aadA Ddam::neo). B. Replacement of dam by neo increased the size of the specific PCR fragment from 1.9 kb to 2.3 kb. Lane 1, DH10B; lane 2, JTU006; lane 3, JTU007 (Ddam::neo)
5. Supplementary Fig. S2
Fig. S2 Confirmation of the methylation status of the E. coli strains. A. Strains containing pSET152 (5.7 kb). B. Strains containing pMM1 (45 kb) and pUZ8002 (60 kb). Note, the yield of pMM1 from ET12567 was low. Plasmid DNA isolated from the strains indicated were digested with restriction endonucleases that are blocked by DNA methylation. MI, MboI (blocked by Dam methylation); EII, EcoRII (blocked by Dcm methylation); UN, undigested samples incubated in buffer without endonuclease. CCC, covalently closed circular plasmid DNA; dim, dimer; doublet, two different DNA fragments superimposed; lin, linearized plasmid; mon, monomer; M, linear kb ladder size markers, largest band 14 kb. Note, that the undigested JTU007 (recA+) samples contained mostly monomeric plasmid while the other strains contained predominantly plasmid dimmers. Note, DH10B should be Dcm+, but pSET152, pMM1 and pUZ8002 isolated from DH10B were partially digested by EcoRII, because of incomplete Dcm methylation in E. coli (11)
6. Supplementary References
1. Bierman M, Logan R, O'Brien K, et al. (1992) Plasmid cloning vectors for the conjugal transfer of DNA from Escherichia coli to Streptomyces spp. Gene 116:43-49
2. Combes P, Till R, Bee S, et al. (2002) The Streptomyces genome contains multiple pseudo-attB sites for the fC31-encoded site-specific recombination system. J Bacteriol 184:5746-5752
3. Durfee T, Nelson R, Baldwin S, et al. (2008) The complete genome sequence of Escherichia coli DH10B: insights into the biology of a laboratory workhorse. J Bacteriol 190:2597-2606
4. Evans GA, Lewis K, Rothenberg BE (1989) High efficiency vectors for cosmid microcloning and genomic analysis. Gene 79:9-20
5. Flett F, Mersinias V, Smith CP (1997) High efficiency intergeneric conjugal transfer of plasmid DNA from Escherichia coli to methyl DNA-restricting streptomycetes. FEMS Microbiol Lett 155:223-229
6. Gust B, Challis GL, Fowler K, et al. (2003) PCR-targeted Streptomyces gene replacement identifies a protein domain needed for biosynthesis of the sesquiterpene soil odor geosmin. Proc Natl Acad Sci USA 100:1541-1546
7. Haldimann A, Wanner BL (2001) Conditional-replication, integration, excision, and retrieval plasmid-host systems for gene structure-function studies of bacteria. J Bacteriol 183:6384-6393
8. Kieser T, Bibb M, Buttner M, et al. (2000) Practical Streptomyces genetics. John Innes Foundation, Norwich
9. Li L, Xu Z, Xu X, et al. (2008) The mildiomycin biosynthesis: initial steps for sequential generation of 5-hydroxymethylcytidine 5'-monophosphate and 5-hydroxymethylcytosine in Streptoverticillium rimofaciens ZJU5119. Chembiochem 9:1286-1294
10. MacNeil DJ, Gewain KM, Ruby CL, et al. (1992) Analysis of Streptomyces avermitilis genes required for avermectin biosynthesis utilizing a novel integration vector. Gene 111:61-68
11. Ringquist S, Smith CL (1992) The Escherichia coli chromosome contains specific, unmethylated dam and dcm sites. Proc Natl Acad Sci USA 89:4539-4543
12. Wang TC, Smith KC (1986) Inviability of dam recA and dam recB cells of Escherichia coli is correlated with their inability to repair DNA double-strand breaks produced by mismatch repair. J Bacteriol 165:1023-1025
13. Weibel EK, Hadvary P, Hochuli E, et al. (1987) Lipstatin, an inhibitor of pancreatic lipase, produced by Streptomyces toxytricini. I. Producing organism, fermentation, isolation and biological activity. J Antibiot (Tokyo) 40:1081-1085
9