MATERIALS AND METHODS
Plasmid constructs
A full length Kv4.2 expression plasmid (pRcCMV/Kv4.2) was obtained from Prof. J.Nerbonne (Washington University, St. Louis) with permission from Prof. L. Jan (University of California, San Francisco). To prepare the dominant-negative truncation, a fragment from the rat Kv4.2 cDNA (kindly provided by Dr M.M. Tamkun, Vanderbilt Medical Center, Nashville) encompassing amino acids 1-311 was fused in frame to a haemoglutinin (HA) epitope tag (Tyr-Pro-Tyr-Asp-Val-Pro-Asp-Tyr-Ala-STOP), resulting in Kv4.2N-HA (Figure 1A). This construct was expressed using the pGW1 expression vector, which utilizes a CMV promoter. A plasmid containing the entire coding sequence of rat Kv1.4 and Kv2.1 were kindly provided by Dr M.M. Tamkun and Dr. R. Joho (SW Medical Center, U. of Texas, Dallas) and sub-cloned into pcDNA3. In our expression studies we routinely cotransfected with a plasmid expressing the green fluorescent protein (GFP) gene, which was kindly provided by Dr J. Nathan (Johns Hopkins University, Baltimore).
Generation of Kv4.2N Transgenic Mice
The Kv4.2N-HA gene was targeted to the heart using regulatory elements from the mouse alpha myosin heavy chain gene (clone 26, kindly provided by Dr. J Robbins, Univ. of Cinn.). Transgenic mice were generated in the B6XCBAF2 background as previously described 1. Mice expressing the transgene were initially identified by Southern blotting using the Kv4.2N fragment and subsequently genotyped by PCR using the following primer pair: (GGAAAGTCACGACTTCACATA) and (AACTGCCCAGCAGAGTGTCTGG).
Northern Blot Analysis
Total RNA was prepared from mouse ventricles using the Trizol method and messenger RNA was prepared using a commercially available kit (Invitrogen). Northern blot analyses was performed using probes to mouse phospholamban (PLB), sarcoplasmic reticular ATPase (SERCA-2A), atrial natriuretic factor (ANF), myosin heavy chain beta (bMHC) and Kv4.2 2. Autoradiographic signals were quantified with NIH Image software and normalized to GAPDH as an internal standard.
Western Blot Analysis
Crude membrane preparations were prepared from pooled mouse hearts and proteins separated by SDS-PAGE, as previously described 3. The transgene was detected using a commercially available monoclonal antibody to the HA epitope tag (Boehringer-Mannheim). Transgene and endogenous Kv4.2 expression was detected using rabbit polyclonal antisera raised against an amino-terminal epitope of the rat Kv4.2 protein (generous gift from Dr. O. Jones, U. of Toronto).
Isolation of mouse ventricular myocytes
Mouse ventricular myocytes were isolated using a modification of the method described previously 3. In brief, mice (13 days - 15 weeks old) were heparinized and killed (under sodium pentobarbital 75 mg Kg-1) by cervical dislocation. Hearts were removed and retrogradely perfused for 7 min with calcium-free Tyrode’s soution at 33-34o C. Following digestion with collagenase (0.45 mg ml-1 type II, Boehringer-Mannheim) and protease (2 mg ml-1 type XIV, Sigma), cells were liberated by gentle trituration with a heat polished pasteur pipette, filtered through nylon mesh and stored in high K+ solution containing (mM): potassium glutamate (120), Kcl (20), HEPES (20), MgCl2 (1), D-glucose (10), K-EGTA (0.5).
Electrical Recordings in ventricular myocytes, oocytes and tsa201 cells.
For electrical recordings myocytes were placed in a bath located on the stage of an inverted microscope. Membrane currents were recorded from Ca2+-tolerant, rod-shaped ventricular myocytes with clear cross striations using the whole-cell configuration of the patch clamp technique [Hamill, 1981 #327]. Cells were bathed in an extracellular (Tyrode’s) solution containing (mM): NaCl (140), CaCl2 (2), CdCl2 (0.5), kcl (4), MgCl2.6H2O (1), glucose (10), HEPES (10), pH 7.4 with NaOH. CdCl2 was added to suppress L-type Ca2+ currents. Pipette tips were heat polished to a resistance of 1-2 MW when filled with a solution containing (mM): Kcl (140), MgCl2.6H2O (1), EGTA (10), HEPES (10), MgATP (5), pH 7.2-7.3 with KOH. Recordings were made within 8 h of cell isolation/replating. After membrane rupture, the capacitance transient was integrated on-line to estimate cell capacitance as a measure of cell size. Series resistance compensation was 70-90%.
Two–electrode voltage-clamp recordings of Xenopus laevis oocytes were performed as previously described (Tsushima et al., 1997). Oocytes were injected with sufficient full length K+ channel plasmid DNA (see above) to induce sub-maximal currents (i.e. 1-10 µA) along with variable amounts of plasmid encoding truncated N-terminal K+ channel fragments and GFP. The recordings were performed on oocytes displaying bright green fluorescence 2-3 days post-injection that were superfused with an ND96 solution containing (mM): NaCl (96), Kcl (2), HEPES (5), MgCl2 (1), CaCl2 (1.8), pH 7.6 with HCl.
Mammalian tsa-201 cells were cultured in minimal essential medium (MEM) supplemented with 10 % fetal bovine serum and gentamicin (50 mg ml-1) and placed in a humidified atmosphere with 5% CO2 at 37o C). The cells were transfected with pRcCMVKv4.2 and equivalent amounts of pGW1HKv4.2N-HA, pGW1HKv1.4N or pGW1H using Lipofectamine (GIBCO BRL) reagents according to the manufacturer's instructions. All reagents for cell culture were purchased from GIBCO BRL. For electrophysiological recordings cells were trypsinized, collected by centrifugation (1000 rpm, 5 min) and replated in growth medium at low density. Immediately prior to recording the culture medium was replaced with a Tyrode’s solution.
Ito was measured as peak current elicited by the depolarizing voltage step minus the current remaining at the end of the 500 ms voltage step (i.e. I500). Current-voltage relationships were constructed by eliciting a series of depolarizing steps (-40 mV to +60 mV) in 10 mV increments from the holding potential (-100 mV for tsa-201 cells or -80 mV for myocytes) at a frequency of 0.1 Hz. In studies involving myocytes, a brief prepulse (-40 mV for 30 ms) was used to inactivate INa. IK1 was measured as a Ba2+-sensitive current using 500 ms steps from -130 mV to 0 mV (10 mV increments) from the holding potential in the presence and absence of 0.3 mM BaCl2. All currents were normalized to cell capacitance (pA/pF). In current-clamp recordings, short (5 ms) depolarizing current pulses sufficient to reach the threshold for INa activation (typically -40 mV) were used to initiate action potentials. Action potentials were elicited at a frequency of 1 Hz and were recorded in the absence of Cd2+.
Microsurgical methods and in vivo hemodynamic measurements
Mice were anesthetized using a mixture of ketamine (50-100 mg/kg) and xylazine (3-6 mg/kg) by intraperitoneal injection. After achieving full anesthesia the mice were placed in a supine position. Following a subcutaneous injection of about 50 µL of a 2% lidocaine solution a midline skin incision was made exposing the trachea, cervical muscles and carotid arteries. Either the right or the left carotid artery was isolated and cannulated with polyethylene tubing (PE-200) which had been stretched after heating to an outer diameter of 150-300 µm and a 20-30 µm wall thickness. To measure pressure, the catheter was connected, via an 18-gauge hypodermic needle, to a TXD-310 low compliance pressure transducer (MicroMed, Louisville KY) and amplified by a blood pressure analyzer (BPA Model 300, MicroMed, Louisville KY). The pressure recording system had a 28 ± 2 Hz roll-off frequency measured at -3dB which might be expected to produce some distortion of our pressure recordings. Using computer simulations of a model system, we estimate that the limited frequency response of this recording system caused less than a 5% underestimation of the peak systolic pressure and less than a 30% underestimation of +/-dP/dt. This analysis revealed that the limitations of the pressure recording system result in a modest underestimation of the hemodynamic differences between the transgenic and nontransgenic groups.
After insertion of the catheter into the carotid artery, the catheter was advanced into the aorta and then into the left ventricle to record the aortic and ventricular pressures. The parameters measured and analyzed were heart rate, aortic pressure, left ventricular (LV) systolic pressure, LV diastolic pressure, and the maximum and minimum first derivatives of the LV pressure (+dP/dtmax and -dP/dtmax, respectively).
Echocardiographic Assessment
Mice were anesthetized as described above for the hemodynamic recordings and examined by transthoracic echocardiography using a 12 MHz probe (Hewlett Packard, Mississauga, Ontario, CA). End-sytolic (ESD) and end-diastolic (EDD) dimensions were recorded and fractional shortening (FS) was calculated as: FS = (EDD-ESD)/EDD. Doppler recordings were also made in these experiments to measure peak blood flow ejection velocities during systole in the proximal outflow region of the aorta.
Monophasic Action Potentials
Action potentials were recorded from the surface of the left ventricles using a close-bipolar configuration 4. Briefly, the recording electrode was comprised of a sintered Ag/AgCl pellet (In Vivo Metric, Healdsburg, CA) with a 0.8 mm diameter encased in polyethylene tubing. A chloridized reference electrode was placed against the outside of this polyethylene tubing about 3-4 mm from the tip of the recording electrode. The heart was mounted horizontally and retrogradely perfused with a Tyrode’s solution (see above) at 37o C. The end of the polyethylene tubing was pressed against the left ventricle near the apex, and the signal was amplified, filtered at 5kHz (-3dB) and stored on a computer for later analysis. The times for 50% and 90% repolarization were recorded.
Statistics.
Where appropriate, data were expressed as mean ± s.e.m and groups were compared using a suitable (hetero- or homoscedastic) unpaired t-test 5. The equivalence of the variance between different groups was determined using the F-statistic combined with the correct F-distribution. In some instances (see below), the data were not normally distributed. In such cases, chi-squared statistics combined with the nonparametric Kolmogorov-Smirnov method were used to determine whether differences existed between transgenic mice and their littermate controls 5.
In young transgenic mice the frequency distribution of the peak Ito amplitude was not well described by the one variable (mono-variate) normal distribution. Therefore, we examined whether a bi-variate normal distribution function gave a statistically better fit to the data. For this purpose, the Marquardt-Levenberg algorithm in conjunction with a non-linear least-squares procedure was used to fit frequency distribution data. The goodness-of-fit to mono- versus bivariate normal distribution function was assessed using the F-distribution of the F-statistic on squared residues obtained from the least-squares fitting procedure 5. Analysis of covariance 5 was used to establish if reductions in Ito correlated with changes in other currents (like IK1 or (I500). In all our statistical analyses a P < 0.05 was considered significant.
Table 3: Electrophysiological Properties
Control / Transgenic / Control /
Transgenic
Capacitance (pF) / 107.5 ± 4.8 (27) / 87.0 ± 3.8* (33) / 156 ± 6 (23) / 232 ± 16* (16)Ito (pA/pF)
Right ventricle / 61.2 ± 4.3 (26) / 48.7 ± 5.4* (33) / 48.4 ± 3.4 (21) / 16.5 ± 3.9* (11)
Ito (pA/pF)
Left ventricle / 57.4 ± 4.3 (22) / 39.6 ± 3.1* (25) / 43.7 ± 4.5 (17) / 25.4 ± 2.4* (33)
APD50 (ms) / 3.5 ± 0.2 (12) / 5.8 ± 0.7* (20) / 3.8 ± 0.3 (8) / 7.7 ± 0.7* (7)
APD90 (ms) / 20.6 ± 2.1 (12) / *35.1 ± 3.5** (20) / 17.5 ± 1.6 (8) / 87.9 ± 19* (7)
MAP
APD50 (ms) / 12.3 ± 1.0 (4) / 49.2 ± 8.3** (3) / 7.8 ± 3.2 (3) / 49 ± 4.3* (3)
MAP
APD90 / 53.5 ± 5.9, (4) / 108.7 ± 11.0* (3) / 50.3 ± 3.7 (3) / 121.0 ± 5.3* (3)
I500 (pA/pF)
@+60mV / 24.4 ± 1.3 (26) / 21.5 ± 1.2 (31) / 32.3 ± 3.6 (21) / 16.4 ± 1.7* (12)
IK1 (pA/pF)
@-130mV / -15.9 ± 1.7 (19) / -15.7 ± 1.4 (13) / -14.8 ± 1.0 (12) / -6.5 ± 0.7* (8)
Resting Potential (mV) / -83.8 ± 0.9 (12) / -83.7 ± 0.7 (16) / -82.3 ± 1.8 (8) / -76.3 ± 1.6* (7)
* (P < 0.05) between age-matched transgenic and control (nontransgenic) mice. Number of individual cells or hearts studied is shown in parentheses.
References
1. De Leon JR, Federoff HJ, Dickson DW, Vikstrom KL, and Fishman GI. Cardiac and skeletal myopathy in beta myosin heavy-chain simian virus 40 tsA58 transgenic mice. Proc Natl Acad Sci U S A. 1994; 91:519-23.
2. Passman RS, and Fishman GI. Regulated expression of foreign genes in vivo after germline transfer. J Clin Invest. 1994; 94:2421-5.
3. Wickenden AD, Kaprielian R, Parker TG, Jones OT, and Backx PH. Effects of development and thyroid hormone on K+ currents and K+ channel gene expression in rat ventricle. J Physiol (Lond). 1997; 504:271-86.
4. Franz MR. Current status of monophasic action potential recording: theories, measurements and interpretations. Cardiovascular Research. 1999; 41:25-40.
5. Zar JH. 1996. Biostatistical Analysis. Prentice-Hall Canada Inc., Toronro.