DNA Replication & Protein Synthesis
01/15/13
I. DNA Replication
II. Protein Synthesis
A. Terms & Concepts
B. Steps
III. Sample Questions
IV. Overview
V. Mutations
VI. Post-Test
Start Recorded Lecture Functions of DNA Part 1 (~40 min.))
I. DNA Replication
- DNA IS THE HEREDITARY MATERIAL. It stores and passes genetic information to future generations.
- The genetic material is passed from a cell to future generations through CELL DIVISION. To pass on the genetic information, the DNA must be copied before the cell divides into two daughter cells.
1. The process of copying the DNA is called DNA Replication.
2. After the DNA is copied the cell divides into two daughter cells.
Each daughter cell receives one complete copy of each chromosome.
(Somatic) CELL DIVISION
Note: Only 4 chromosomes are shown in the cell below. In humans, all 46 chromosomes (23 from the mother and 23 from the father) will undergo this process.
Complete Part 1 Self-Evaluation Questions
Start Recorded Lecture ‘Functions of DNA’ Part 2 (~15 min.)
II. Protein Synthesis
A. Terms & Concepts
1. DNA determines what proteins the cell can produce.
2. The SEQUENCE (ORDER of the N bases) in ONE GENE is a code for the amino acids in one protein.
a. Gene: A section of DNA that contains the instructions for making one protein.
There are different genes in human DNA.
b. Amino Acid:
c. Protein:
- The production of proteins is called protein synthesis.
The flow of information from DNA (genotype) to the
final outward appearance of a trait (phenotype):
DNA→RNA→protein→TRAIT
Complete Part 2Self-Evaluation Questions
1
Start Recorded Lecture ‘Functions of DNA’ Part 3 (~18 min.)
B. Steps of Protein Synthesis
Transcription: Synthesizing RNA
transcription
DNA→RNA-Occurs in the nucleus
What is RNA?
I.STEPS of Transcription (Very similar to DNA Replication. Why is that?)
1) The DNA unzips in ONE GENE.
1
2) RNA nucleotides bond to the unzipped area of the DNA, BUT ONLY ON ONE STRAND OF THE DNA.
3) The sugar of one RNA nucleotide must be bonded to the phosphate of the next RNA nucleotide.
4) When the entire gene is transcribed into RNA, the RNA is released from the DNA.
5) The DNA rezips.
6) The RNA usually moves out of the nucleus to the cytoplasm.
Complete Part 3 Self-Evaluation Questions
1
Start Recorded Lecture ‘Functions of DNA’ Part 4 (~36 min.)
Translation: Synthesizing Proteins
1) Summary
ribosomes, amino acids
RNA→protein-Occurs?
1
The shape (structure) of the protein determines its function. The shape of the protein depends on the types and order of amino acids that make up the protein.
The genetic code specifies what types of amino acids and their order in the protein.
2) Genetic Code
a. Triplet code: 3 RNA nitrogen bases code for 1 amino acid
b. Each sequence of 3 N-bases is called a CODON
c. Ex.:
AUGUUUCCG
The table on the next page shows which amino acids correspond to every possible triplet combination.
Genetic Code Chart:
UUU / Phe / UCU / Ser / UAU / Tyr / UGU / CysUUC / Phe / UCC / Ser / UAC / Tyr / UGC / Cys
UUA / Leu / UCA / Ser / UAA / STOP / UGA / STOP
UUG / Leu / UCG / Ser / UAG / STOP / UGG / Trp
CUU / Leu / CCU / Pro / CAU / His / CGU / Arg
CUC / Leu / CCC / Pro / CAC / His / CGC / Arg
CUA / Leu / CCA / Pro / CAA / Gln / CGA / Arg
CUG / Leu / CCG / Pro / CAG / Gln / CGG / Arg
AUU / Ile / ACU / Thr / AAU / Asn / AGU / Ser
AUC / Ile / ACC / Thr / AAC / Asn / AGC / Ser
AUA / Ile / ACA / Thr / AAA / Lys / AGA / Arg
AUG / Met / ACG / Thr / AAG / Lys / AGG / Arg
GUU / Val / GCU / Ala / GAU / Asp / GGU / Gly
GUC / Val / GCC / Ala / GAC / Asp / GGC / Gly
GUA / Val / GCA / Ala / GAA / Glu / GGA / Gly
GUG / Val / GCG / Ala / GAG / Glu / GGG / Gly
Amino acid three-letter and one-letter abbreviations:
Glycine / Gly / G / Serine / Ser / SAlanine / Ala / A / Threonine / Thr / T
Valine / Val / V / Cysteine / Cys / C
Leucine / Leu / L / Methionine / Met / M
Isoleucine / Ile / I / Asparagine / Asn / N
Proline / Pro / P / Glutamine / Gln / Q
Phenylalanine / Phe / F / Aspartate / Asp / D
Tyrosine / Tyr / Y / Glutamate / Glu / E
Tryptophan / Trp / W / Lysine / Lys / K
Arginine / Arg / R / Histidine / His / H
-An amino acid is coded for by a group of 3 consecutive RNA bases. There is however, redundancy in the code. To explain, there are 64 possible combinations of the 4 nucleotides in groups of 3, yet there are only 20 amino acids. Thus many of the amino acids have more than one combination that code for its incorporation in a polypeptide.
UUA / LeuUUG / Leu
CUU / Leu
CUC / Leu
CUA / Leu
CUG / Leu
-Through evolution, different species have developed a preference for certain codons for certain amino acids.
Self-reading: Ingested proteins are usually broken up into single amino acids or dipeptides in the small intestine, and then absorbed. They can then be joined together to make new proteins. Humans and other mammals can only synthesize half of the amino acids. They cannot synthesize isoleucine, leucine, lysine, methionine, phenylalanine, threonine, tryptophan, and valine. These are the essential amino acids, since it is essential to ingest them. Mammals do possess the enzymes to synthesize alanine, asparagine, aspartate, cysteine, glutamate, glutamine, glycine, proline, serine, and tyrosine, the nonessential amino acids. While they can synthesize arginine and histidine, they cannot produce it in sufficient amounts for young, growing animals, and so these are often considered essential amino acids.
3. Steps of Translation
(1) The RNA synthesized during transcription attaches to the ribosome.
(2) Amino acids are placed in the order specified by the codons in the RNA.
(3) Peptide bonds are formed between each amino acid.
(4) After each amino acid is bonded to the previous amino acid, the ribosome moves down one codon.
(5) When all of the amino acids have been bonded together, the ribosome, RNA, and protein are separated. The polypeptide is altered as necessary, transported to the area of the cell where it is needed or it may be secreted outside of the cell.
III. Sample questions:
A portion of a gene has the following sequence:
...CTTCCTACATAGTGGTTG...
1. What is the sequence of the RNA?
2. How many codons are in the above RNA?
3. What amino acids are in the protein?
1
Complete Part 4 Self-Evaluation Questions
Start Recorded Lecture ‘Functions of DNA’ Part 5 (~21 min.)
Overview: Protein Synthesis:
IV. Overview of both DNA Functions:
V. Mutations: Germline vs. Somatic cell
When finished, complete Part 5 Self-Evaluation Questions
Functions of DNA
Post-Test
1. Some definitions are given below. Write the appropriate word for each of the definitions below.
a. The only cells of the body that contain twenty-three chromosomes, one of each homologous pair. (other names are sex cells, germ cells, eggs/sperm)
b. The process of copying all 46 chromosomes before cell division.
c. A specific location on a chromosome.
d. Breaking the bonds between the nitrogen bases in the double helix.
e. After DNA replication, the two exact copies of the chromosomes are connected at this position on the chromosome.
f. Pairs of chromosomes (one from the mother and one from the father) that are the same size, have the same genes for the same traits at the same loci, and have centromeres in the same locations.
g. The first stage of protein synthesis; occurs in the nucleus; one strand of the DNA in ONE GENE is copied into RNA.
h. The three nitrogen bases in the RNA that code for one amino acid.
i. The second stage of protein synthesis; the amino acids are bonded in a specific sequence as instructed by the genetic code.
j. The building blocks of proteins.
k. An organelle in the cell which provides a structure (and some enzymatic functions) for the translation stage of protein synthesis; it is here that the instructions in the RNA are used to bond amino acids in the correct order, forming proteins.
l. Alternate forms of the same gene.
2. What function of DNA is involved in the storage and transmission of genetic information to future generations?
3. When does DNA replication occur?
4. Why does DNA replication occur in cells?
5. How many chromosomes does each body cell receive after cell division?
6. Put the following steps of DNA Replication in order (1-4).
--Completed sister chromatids are connected at the centromere.
--Bonds between the nitrogen bases in the original (parental) DNA break.
--"Free" DNA nucleotides bond to complementary, unbound nucleotides in the
original DNA strands.
--The ‘new’ DNA nucleotides are bonded to each other.
7. How many total base pairs do humans have in their DNA(in one ‘set’)?
8. How many genes do humans have? (in one ‘set’)
9. How many base pairs are in a gene on average?
10. What is the excess DNA (the DNA not forming genes) called?
11. Describe the "flow" of information in protein synthesis.
12. What is broken during DNA unzipping?
13. What are the two stages of protein synthesis?
14. What is formed by transcription?
15. What nitrogen base is found in RNA but not DNA, and what nitrogen base is it complementary to?
16. Put the following steps of transcription in order (1-4).
--"Free" RNA nucleotides bond to the unzipped area of the DNA.
--The DNA unzips in one gene.
--The DNA rezips.
--The RNA nucleotides are bonded to each other.
17. How many strands of the DNA does the RNA bond to?
18. What are the differences between RNA and DNA nucleotides?
19. What is a "free" DNA or RNA nucleotide?
20. Where does transcription occur in the cell?
21. What happens to the completed RNA after it is released from the DNA?
22. What is the second stage of protein synthesis?
23. Where does the second stage of protein synthesis occur in the cell?
24. What are the building blocks of proteins?
25. In the genetic code, how many nitrogen bases code for one amino acid?
26. What is each of the above called?
27. Put the following steps of translation in order (1-3).
--The ribosome, the RNA, and the protein are separated.
--The RNA attaches to the ribosome.
--Amino acids are placed in the order specified by the codons.
28. Another name for protein is…
29. Below is a portion of DNA.
GGAGCATCACCATTTTAAGTCATC
a. What is the sequence of RNA formed by bonding to the above strand of DNA?
b. How many codons are in the above RNA?
c. What amino acids are coded for in the above RNA?
d. Where is the above RNA located in the completed RNA strand?
30. What determines the function of a protein?
31. What happens to the polypeptide after translation?
32. Every person has two number one chromosomes, one from his/her mother and the other from his/her father. How many sister chromatids do each of these number one chromosomes have after DNA Replication?
33. Describe how the structure of DNA relates to its functions.
34. Why is DNA unzipping important to the functions of DNA?
35. What is the difference between sister chromatids and homologous chromosomes?
36. Draw sister chromatids.
37. Draw one pair of homologs.
38. Compare and contrast DNA replication and protein synthesis.
39. What are sister chromatids and how are they formed? What happens to the sister chromatids during cell division? Why?
40. Describe the differences between: chromosome, DNA, gene, allele, and locus.
Cont’d
41. Relate the following to cookbooks, cakes, birthday decorations (candles, etc.), recipes, utensils, ingredients, etc. required to make a completed birthday cake.
(You may want to refer to “The Cell” lecture guide (Synthesis and Modification of a Protein).
Write the analogy and explain the rationale
Making a functional proteinMaking a birthday cake
a. 46 chromosomes:
b. One chromosome:
c. Gene:
d. Base pairs in one gene:
e. RNA:
e. Amino acids:
f. Ribosome:
g. Nonfunctional protein
h. ER , Golgi, Enzymes:
i. Functional protein:
j. Vesicle:
k. Mitochondria:
42. Write the steps of DNA replication. Fill in examples of nitrogen bases (A, T, C, G).
1