In Vitro Non-Homologous End Joining (NHEJ) Activity Assay

Supplementary Methods

In vitro Non-homologous end joining (NHEJ) activity assay

Standard cell free in vitroNHEJ was performed as described previously with few modifications(1). Linearized plasmid substrates (pCR4-TOPO)with cohesive ends were generated by restriction digestion with EcoRI (Thermo Scientific, Cat # FD0274) and purified using Qiagen gel extraction kit (Valencia, CA).Two hundred fifty nanogram of the purified linearized plasmid substrate was incubated with 1 µg of nuclear protein extracts from U251 cells or 2 µg of total extracts from U251 tumors in the end joining reaction buffer (10X NHEJ buffer: 200mM HEPES pH 7.5 at RT, 800mM KCL, 100mM MgCl2 and 1mM ATP (20mM stock stored at -20 C), 1mM DTT (20mM stock stored at -20 C) should be added freshly to 1X reaction mixture just before use) in a 30-µL reaction volume for 1 h at 37°C. The reaction mixture was deproteinized with 1 mg/ml proteinase K at 65°C for 30 min and then was separated by electrophoresis on a 0.7% agarose gel for 2 h at 60 V. DNA was detected using a gel imaging system (Fuji) after staining with syber green (SYBR® Gold Nucleic Acid Gel Stain S11494, Invitrogen).

Homologous Recombination (HR) assay

A PCR based rapid and sensitive method for measuring the efficiency of HR was used according to the manufacturer’s instructions (Norgen Biotek Corp., Ontario, Canada). Briefly, U251 cells were first transfected with siMPS1/siNegative, followed by a second co-transfection with the two HR dl plasmids(dl-1 and dl-2) 24 hrs after the first transfection. Total DNA was extracted by Trizol (Invitrogen) method 24 hrs after the second transfection and HR activity was quantified through qPCR using the supplied primers. The assay primer mixture provided with the kit is designed to amplify only the homologous recombination product but not the dl plasmids. Positive control plasmid supplied with the kit was used as a positive control for the reaction.

In vivo NHEJ and HR assays using DR-GFP plasmid

U251 cells were stably transfected with Lipofectamine as recommended by the manufacturer (Invitrogen) with 2 ug of circular pDR-GFP (Plasmid 26475., AddGene ., USA) , stable Puromycin-resistant colonies were selected with 2 to 6 μg/mL puromycin (cat: ant-pr-1., InvivoGen.,USA). Selected U251-DR-GFP cells were maintained in DMEM medium supplemented with 10% fetal bovine serum (Invitrogen). The recombination assay relies on the two inactivated tandem repeated (DR)-GFP plasmid developed by M. Jasin (2). The system utilizes the I-SceI rare-cutting endonuclease from Saccharomyces cerevisiae expressed from an plasmid pCBASceI (Plasmid 26477., AddGene) expression vector with mammalian promoter to introduce a DSB at a genomic I-SceI site (3).Upon infection with of pCBASceI , a single site-specific DSB is generated with a number of different scenarios possible; the break can simply religate without any evidence of DNA cleavage, or the ends can be joined by NHEJ and at the same time destroy the I-SceI site, or HRR may use the 3′ internal copy of GFP DNA as a homologous template for repair, resulting in GFP+ cells(4).

Treatments:

U251-DR-GFP cells (0.5 million in 60mm dishes) were treated with drug (NMSP715), 4 hours post transfection with 2ug I-SceI plasmid (pCBASceI) or mock. For siRNA mediated MPS1 knock down, U251-DR-GFP cells were transfected with siRNA 24 hours prior to I-SceI transfection. Analysis was carried out 48 hours after I-SceI +/- transfection.

GFP Analysis

GFP flow cytometry was performed on live cells by Fluroscence Flow cytometer (BD FACS caliber). Flow data was analysed using Flowing Software (

PCR based HR and NHEJ- DSB repair activity.

Genomic DNA was extracted using TRIZOL (Invitrogen) and HRR activity by PCR analysis was confirmed as described elsewhere (4), using two 5’ primers, unrec (5’-GCTAGGGATAACAGGGTAAT-3’ 438bp), amplified nonrecombinant units, and and rec (5’- GAGGGCGAGGGCGAATGCC-3’ 436bp) amplified only recombined units. The reverse 3’ end primer( 5’-TGCACGCTGCCGTCCTCG-3’) was present only in cassette I but not in cassette II. PCR was performed in 50-μl reaction mixture containing 0.5ug of recovered DNA. Amplifications were performed using following conditions: 95 °C/10 min × 1 cycle; 95 °C/45 sec, 55 °C/30 sec, and 72 °C/1 min × 40 cycles; and 72 °C 10 min × 1 cycle. 20ul of the Amplified PCR products were separated on 1.2% agarose gel (Invitrogen) and stained with ethidium Bromide (EtBr) (Sigma Aldrich) . Image J software( NIH) was used to quantify the mean band intensities.

For NHEJ activity, a different set of DR-GFP specific primers (DRGFP-F, CTGCTAACCATGTTCATGCC; DRGFP-R, AAGTCGTGCTGCTTCATGTG) were used as described elsewhere (5, 6). These primers generated 650bp PCR product containing a preserved BcgI restriction site as a result of HR activity. This BcgI restriction site is lost if the repair is result of NHEJ activity. Taking advantage of this repair system, the amplified PCR products were digested with I-SceI + BcgI restriction enzymes as per manufacturer instructions (I-SceI R0694., BcgI-R0545., Biolabs) and subjected to gel electrophoresis using 1.2% agarose gel.(Note: All the I-SceI digested products represent un-recombined events) .The enzyme resistantfragments represent NHEJ events, their band intensities were quantified by imageJ software (National Institutes of Health).

Bioinformatics analysis of publically available datasets

MPS1 expression levels were correlated to patient survival by curating publically available datasets. Multivariate survival analysis was carried out using a Cox Proportional Hazards model to assess the statistical significance of MPS1 expression on patient survival for an independent cohort of 197 GBM patients from The Cancer Genome Atlas (TCGA) using GBM-BioDP web tool (manuscript submitted). The GBM-BioDP uses datasets and clinical information derived from The Cancer Genome Atlas (TCGA) data portal ( The analysis was carried out in R. Expression data from three platforms (Affymetrix HGU133A, Agilent G4502A, and HuEx-1_0-st-v2) for 197 GBM tumors were aggregated following Verhaak et al. (7). The tumors were stratified according to GBM molecular subclasses (classical, mesenchymal, proneural, and neural) as identified by Verhaak et al. (7).The joint effect of three covariates –MPS1 expression stratified as below and above median, age at diagnosis, and MGMT methylation status – was assessed using multivariate Cox regression. The differences in survival were tested using log-rank analyses for each subclass. The impact of each covariate was assessed by the covariate's hazard ratio, and its associated p-value. A log-rank of <=0.05 and a p-value <=0.05 were considered statistically significant. Univariate survival analysis by was carried out on data from individuals withbreast orlung cancer using data from Gene Expression Omnibus (GEO, Affymetrix HGU133A and HGU133+2 microarrays), The European Genome-phenome Archive (EGA) and TCGA. To plot survival data we used KM-Plotter ( the data is shown as standard Kaplan-Meier curves(8, 9).Differences were considered to be statistically significant when p-value< 0.05.

References

1.Iliakis G, Rosidi B, Wang M, Wang H. Plasmid-based assays for DNA end-joining in vitro. Methods Mol Biol. 2006;314:123-31.

2.Pierce AJ, Johnson RD, Thompson LH, Jasin M. XRCC3 promotes homology-directed repair of DNA damage in mammalian cells. Genes & development. 1999;13:2633-8.

3.Richardson C, Moynahan ME, Jasin M. Double-strand break repair by interchromosomal recombination: suppression of chromosomal translocations. Genes & development. 1998;12:3831-42.

4.Cuozzo C, Porcellini A, Angrisano T, Morano A, Lee B, Di Pardo A, et al. DNA damage, homology-directed repair, and DNA methylation. PLoS genetics. 2007;3:e110.

5.Wu J, Zhang X, Zhang L, Wu CY, Rezaeian AH, Chan CH, et al. Skp2 E3 ligase integrates ATM activation and homologous recombination repair by ubiquitinating NBS1. Molecular cell. 2012;46:351-61.

6.Ha GH, Kim JL, Petersson A, Oh S, Denning MF, Patel T, et al. TACC3 deregulates the DNA damage response and confers sensitivity to radiation and PARP inhibition. Oncogene. 2014;0.

7.Verhaak RG, Hoadley KA, Purdom E, Wang V, Qi Y, Wilkerson MD, et al. Integrated genomic analysis identifies clinically relevant subtypes of glioblastoma characterized by abnormalities in PDGFRA, IDH1, EGFR, and NF1. Cancer cell. 2010;17:98-110.

8.Gyorffy B, Lanczky A, Eklund AC, Denkert C, Budczies J, Li Q, et al. An online survival analysis tool to rapidly assess the effect of 22,277 genes on breast cancer prognosis using microarray data of 1,809 patients. Breast cancer research and treatment. 2010;123:725-31.

9.Gyorffy B, Lanczky A, Szallasi Z. Implementing an online tool for genome-wide validation of survival-associated biomarkers in ovarian-cancer using microarray data from 1287 patients. Endocrine-related cancer. 2012;19:197-208.

Supplementary Figure Legends

Supplementary Figure 1:Inhibition of MPS1 activity compromises the viability of GBM tumor cells

The human GBM cell line U251 was transfected with three different non-overlapping siRNAs corresponding to MPS1 (siMSP1), or negative (siNeg) siRNA in triplicate. Gene-specific qPCR (GAPDH normalized) (A) and Western blot analysis (B) were used to assess the efficacy of gene silencing at 48 hours post-transfection. Actin is shown as a loading control for Western blot analysis.

Supplementary Figure 2: Molecular profiling reveals changes in genes associated with DNA replication, recombination and repair

(A)Two-way hierarchical clustering representation of mRNA expression profile of siMPS1 silenced U251 cells compared to siNeg transfected or untransfected cells (Control) at 6, 24 and 48 hours post-transfection. Values shown derived using a cutoff p-value < 0.05. Up-regulation, red; down-regulation, blue. (B, C) Ingenuity Pathway Analysis of top networks generated from processing mRNA targets from siMPS1 transfected cells, (B)Associated Network Functions and (C) Molecular network showing involvement of DNA damage and repair molecules. (D) U251 cells were transfected with either siNeg or siMPS1 and 48 hours post transfection expression of DNAPK and TOPO2A was assessed using gene specific RT-PCR (GAPDH normalized). Untransfected cells (Ctrl) are also shown. Data presented are the mean ± the standard deviation from three independent experiments.

Supplementary Figure 3

(A) Western blot analysis of pDNAPK and DNAPK from 2.5 uM NMS-P715 treated and irradiated (4 Gy) U251 cells. Actin was used as a loading control.

(B) To assay homologous recombination (HR) activity, U251 cells were transfected with two HR plasmids and positive or negative control plasmids. Total DNA was extracted 24 hours post-transfection and amplified using HR specific primers.

(C) U251 cells growing in chamber slides were exposed to NMS-P715 for various time points and processed for immunocytochemical analysis of mitotic catastrophe. Nuclear fragmentation (defined as the presence of two or more distinct lobes within a single cell) was evaluated in at least 150 cells per treatment per experiment and represented as % mitotic catastrophe.

Supplementary Figure 4

To assay homologous recombination (HR), U251 DR-GFP cells were transfected with pCBAScel vector and harvested at 48 hours after indicated treatments. GFP+ve cells representing HR repair events were determined by flow cytometry and PCR based assays. (A, C) represents two-dimensional plot of GFP-specific fluorescence –FL1 (on Y axis )versus light scatter (x-axis) to identify GFP+ve cells, (B, D) represent bar graph of percentage GFP+ve cells. Two different concentrations of BO2 (RAD51 inhibitor) were used as a positive control. (E)Genomic DNA was harvested and HR activity was confirmed by PCR analysis. Amplified PCR products were separated on 1.2% agarose gel (Invitrogen) and stained with ethidium bromide. (F) bar graph of fold change in recombined PCR product quantified using NIH imageJ software is shown on top and PCR gel electrophoresis on bottom. * indicate p<0.05.

Supplementary Figure 5

To assay nonhomologous end joining (NHEJ), U251 DR-GFP cells were transfected with pCBAScel vector and harvested at 48 hours after indicated treatments. Genomic DNA was harvested for PCR amplification using DR-GFP primers, followed by I-Scel+Bcgl enzyme digestion and PCR products were subjected to gel electrophoresis. (A) Represents PCR amplified and enzyme digested products of control U251 DR-GFP cells alone. * indicate p<0.5. NU7441, a DNAPK inhibitor was used as a positive control for NHEJ activity.(B) Represents bar graph of fold change in band intensities of enzyme-resistant fragments (650 bp) normalized to uncut products quantified using imageJ software (National Institutes of Health).

Supplementary Figure 6

Kaplan-Meier curve analysisexaminingMPS1 expression (red- high expression, black- low expression) and overall survival association in 1115 breast (A) and 1405 lung (B) cancer patients using univariate analysis using KM-Plotter (

1