Molecular detection of haemoparasites in dogs in Mnisi Mpumalanga province, South Africa
A O Kolo 1, K Sibeko-Matjila1, D Knobel1 and P T Matjila2
1Department of Veterinary Tropical Diseases, Faculty of Veterinary Science, University of Pretoria, Private Bag X04, Onderstepoort, 0110 South Africa; 2Department of Life and Consumer Sciences, University of South Africa, P.O Box 392, UNISA 0003;
ABSTRACT: Canine vector-borne diseases have a worldwide distribution and are increasingly significant as emerging diseases. They are caused by various pathogens and transmitted via the bites of arthropods like ticks and fleas. The aim of this study was to screen for haemoparasites in blood samples collected from domestic dogs in the Mnisi area of Bushbuckridge, Mpumalanga Province in South Africa. A total of 141 blood samples were collected from October 2011 through May 2012 and spotted onto FTA filter cards. All samples were screened for the presence of Ehrlichia, Anaplasma, Theileria and Babesia species using a reverse line blot (RLB) hybridization assay.
Results indicated that 23/141 (16.3%) of the samples investigated were positive for Ehrlichia canis, 14/141 (9.9%) for Babesia rossi, while 6/141 (4.25%) were positive for Babesia vogelli, 31/141 (21.9%) of samples were positive for the genus-specific probe 1 of Babesia, 21/141 (14.89%) were positive for the genus-specific probes of Theileria/Babesia , 3/141 (2.12%) were positive for the genus-specific probe of Theileria, 2/141 (1.41%) was positive for the genus-specific probe 2 of Babesia. The remaining majority of samples only reacted with the genus-specific probes for Ehrlichia/Anaplasma 70/141 (49.6%). Haemoparasite DNA could not be detected in 51/141 (36.1%) of samples. These preliminary data indicated that E. canis was the most common haemoparasite of dogs in Mnisi. DNA samples that only reacted with genus-specific probes will be sequenced to determine if these are novel parasite species or variants of existing species.
1. Introduction.
Canine vector-borne diseases are of great veterinary significance and are among the most common diseases of dogs in tropical, sub-tropical and temperate regions of the world (Yisaschar-Mekuzas et al, 2013). They are transmitted by arthropods like ticks, fleas, sand flies and mosquitoes (Otranto et al, 2009). Dogs can serve as competent reservoir hosts for several zoonotic pathogens like Anaplasma phagocytophilum, Ehrlichia canis and Rickettsia conorii (Otranto et al, 2009). Common inthraerythrocytic piroplasms of dogs include Babesiosis caused by Babesia canis canis, Babesia canis vogelli, Babesia canis rossi and smaller piroplasms like Babesia gibsoni, B. conradae, and Theileria annae (Babesia microti), (Yisaschar-Mekuzas et al, 2013). The disease is found in tropical and semi-tropical countries worldwide and transmitted by members of the tick family Rhipicephalus sanguineus and Haemophysalis leachi (Shaw et al, 2001). Theileria annae is known to cause disease in domestic dogs (Zahler et al, 2000; Guitian et al, 2003; Camacho et al, 2004; Camacho Garcia, 2006). In South Africa, previous studies using molecular techniques have detected a Theileria specie in dogs that was associated with haemolytic disease (Matjila, Leisewitz et al, 2008). Ehrlichiosis caused by Ehrlichia canis is found in Southern Europe, Middle East and Africa and transmitted by the ticks R. sanguineus and members of the Amblyomma family (Mumcuoglo et al, 1993). Hepatozoonosis caused by Hepatozoon canis commonly infects dogs in Southern Europe, Africa and the Middle East and is also transmitted by the ticks R. sanguineus and Amblyomma maculatum (Baneth et al, 2003). Diagnosis of these diseases is usually by microscopy, serological tests like the immunofluorescent antibody test (IFAT) and molecular diagnostics using PCR (Day & Shaw, 2005); control is primarily by vector control, keeping dogs free of tick exposure by use of systemic or topically applied acaricides (Day & Shaw, 2005).
The objective of this study was to screen blood samples collected from domestic dogs in the Mnisi area in Bushbuckridge for haemoparasites with the use of the reverse line blot (RLB) assay to detect parasites in the genera Babesia, Theileria, Anaplasma and Ehrlichia present in this locality. The RLB assay is sensitive enough to differentiate between single nucleotide polymorphisms and has been widely used for the detection of infection (Gubbels et al, 1999; Schouls et al, 1999 & Bekker et al, 2002).
2. Materials and Methods
2.1 Sample collection
A Health and Demographic Surveillance System in Dogs (HDSS-Dogs) was established in Mnisi in Bushbuckridge, Mpumalanga Province in 2011, with funding from the Morris animal foundation, USA. Blood samples were collected from 141 dogs present at households visited by the HDSS-Dogs field team. Blood was collected directly on capillary tubes and spotted on sterile FTA filter paper.
2.2 DNA extraction and PCR amplification
DNA was extracted from blood spotted on filter paper. Samples spotted on filter paper were cut out using individual sterile scalpel blades, and transferred into sterile tubes. DNA was extracted using the QIAamp DNA mini kit (Qiagen) according to the manufacturer’s instructions. Eluted DNA was stored at -20°C until further analysis by PCR.
PCR was conducted with a set of primers that amplified a 460-540 bp fragment of the 18S SSU rRNA gene spanning the V4 region for Theileria/Babesia and the V1 hypervariable region of the 16S ribosomal RNA gene Ehrlichia/Anaplasma (Gubbels et al, 1999; Bekker et al, 2002; Matjila et al, 2004). Table 1 shows the primer sequence used for the Theileria/Babesia, and Ehrlichia/Anaplasma PCR. Known positive samples were used as controls and PCR grade water was used as negative control.
Table 1: Primer sequence for PCR.
Genus / Primer / Primer Sequence(5’-3’)Babesia and Theileria / RLB-F2
RLB-R2 / GACACAGGGAGGTAGTGACAAG CTAAGAATTTCACCTCTGACAGT
Erhlicia and Anaplasma / Ehr-F
Ehr-R / GGA ATT CAG AGT TGG ATC MTG GYT CAG
CGG GAT CCC GAG
TTT GCC GGG ACT TYT TCT
The PCR reaction (25µl) contained 5µl of DNA template with 12.5 µl of Platinum Quantitative PCR SuperMix-UDG (Invitrogen) which contains 60 U/ml platinum Taq DNA polymerase, 40 mM Tris-HCl (pH 8.4), 100 mM KCl, 6 mM MgCl2, 400 µM dGTP, 400 µM dATP, 400 µM dCTP, 400 µM dUTP, 40 U/ml UDG, and stabilizers. The reaction mixture contained 0.25 µl of each primer (forward and reverse), and 7 µl of PCR grade water. The reactions were performed on a thermal cycler, with an initial cycle for 3 min at 37 °C, 10 min at 94°C, 10 cycles of 94°C (20 sec)-67°C (30 sec)-72°C (30 sec) with the annealing step lowered every second cycle by 2°C, followed by 40 cycles of denaturation for 30 sec at 72°C and annealing at 57°C also for 30 sec. The final extension was performed for 7 min at 72°C to complete the program.
2.3 Reverse line blot hybridization assay
Reverse line blot was performed on the PCR products as described by (Gubbels et al, 1999; Schouls et al, 1999; Matjila et al, 2004). A blotting membrane was activated by 10-min incubation in 10 ml of 16% 1-ethyl-3-(3-dimethyl-amino-propyl) carbodiimide (EDAC) at room temperature. The membrane was washed for 2 min with distilled water and placed in an Immunokinetics miniblotter. Specific oligonucleotide probes (volume 8 µl) were diluted by adding 142 µl of 0.5 M NaHCO3 (pH 8.4) to 200 µl labeled tubes; and were subsequently covalently linked to the membrane with the amino linker by filling the miniblotter slots with the oligonucleotide dilutions. They were then incubated for 2 min at room temperature. The oligonucleotide solutions were aspirated, and the membrane was inactivated by incubation in 100ml of a 100 mM NaOH solution for 8 min at room temperature on a shaker. The membrane was washed with shaking in 100 ml of 2 X SSPE/0.1% sodium dodecyl sulfate (SDS) for 5 min at 60°C (2 X SSPE contains 360 mM NaCl, 20 mM NaH2PO4 and 2 mM EDTA-pH 7.4). Before use, the membrane was washed for 5 min at 42°C with 50 ml of 2 X SSPE/0.1% SDS under gentle shaking and placed in the miniblotter with the slots perpendicular on the previously applied specific oligonucleotides. PCR products were diluted by adding 130 µl of 2 X SSPE/0.1% SDS, and denatured for 10 min at 99.9°C on a thermal cycler machine. Denatured PCR products were applied to slots and hybridized in incubator at 42°C for 60 min, then aspirated. The membrane was then washed twice in preheated 2 X SSPE/0.5% SDS for 10 min at 50°C in the incubator under gentle shaking, and then incubated with 10 ml 2 X SSPE/0.5% SDS with 12.5 µl streptavidin-POD (peroxidase labeled) conjugate for 30 min at 42°C on a shaker. The membrane was then washed twice in preheated 2 X SSPE/0.5% SDS for 10 min at 42°C; and washed twice again with 2 X SSPE for 5 min at room temperature under gentle shaking. Ten ml of ECL detection fluid (5 ml ECL 1 and 5 ml ECL 2) was added onto the membrane for 1 min at room temperature before exposure to an X-ray film and subsequent development. The PCR products were stripped from the membrane by washing it twice with 200 ml pre-heated 1% SDS at 30 min at 80°C; under gentle shaking followed by a 2nd wash with 200 ml 20 mM EDTA for 15 min at room temperature. The membrane was then sealed in a plastic container in 50 ml 20 mM EDTA at 4°C for re-use (Gubbels et al, 1999). The sequences of the oligonucleotide probes used in this study are presented in Table 2.
Table 2: Probe sequences for specific detection of parasite species
Probe Target / Sequence 51-31 / Probe SourceE/A catch all / GGG GGA AAG ATT TAT CGC TA / Matjila et al, 2004
A. centrale / TCG AAC GGA CCA TAC GC / Matjila et al, 2004
A.marginale / GAC CGT ATA CGC AGC TTG / Matjila et al, 2004
A. phago / GRATARTTAGTGGCAGACGGGT / Matjila et al, 2004
E. ruminantium / AGT ATC TGT TAG TGG CAG / Matjila et al, 2004
A. bovis / CTTGCTATGAGAAYAATTAGTGGC / Matjila et al, 2004
E. chaffiensis / ACC TTT TGG TTA TAA ATA ATT GTT / Matjila et al, 2004
E.sp. omajienne / CGG ATT TTT ATC ATA GCT TGC / Matjila et al, 2004
E. canis / TCT GGC TAT AGG AAA TTG TTA / Matjila et al, 2004
T/B catch all / TAA TGG TTA ATA GGA RCR GTT G / Matjila et al, 2004
T. catch all / ATT AGA GTG CTC AAA GCA GGC / Matjila et al, 2004
B. catch all 1 / ATT AGA GTG TTT CAA GCA GAC / Matjila et al, 2004
B. catch all 2 / ACT AGA GTG TTT CAA ACA GGC / Matjila et al, 2004
B. felis / TTA TGC GTT TTC CGA CTG GC / Matjila et al, 2004
B. divergens / TGACTAATGTCGAGATTGCACTTC / Matjila et al, 2004
B. microti / GRC TTG GCA TCW TCT GGA / Matjila et al, 2004
B. bigemina / CGT TTT TTC CCT TTT GTT GG / Matjila et al, 2004
B. bovis / CAG GTT TCG CCT GTA TAA TTG AG / Matjila et al, 2004
B. rossi / CGG TTT GTT GCC TTT GTG / Matjila et al, 2004
B. canis / TGC GTT GAC CGT TTG AC / Matjila et al, 2004
B. vogelli / AGC GTG TTC GAG TTT GCC / Matjila et al, 2004
B. major / CGCTGTGGCTTATCCTTTTAC / Matjila et al, 2004
B. bicornis / TTGGTAAATCGCCTTGGTCG / Matjila et al, 2004
B. caballi / GTG TTT ATC GCA GAC TTT TGT / Matjila et al, 2004
B. gibsoni / TAC TTG CCT TGT CTG GTT T / Matjila et al, 2004
B. sable / GCG TTG ACT TTG TGT CTT TAG C / Oosthuizen et al, 2008.
T. bicornis / GCG TTG TGG CTT TTT TCT G / Matjila et al, 2004
T. annulata / CCT CTG GGG TCT GTG CA / Matjila et al, 2004
T. buffeli / GGC TTA TTT CGG WTT GAT TTT / Matjila et al, 2004
T. mutans / GCGGCTTATTTCGGACTYG / Matjila et al, 2004
T. parva / GGA CGG AGT TCG CTT TG / Matjila et al, 2004
T. taurotragi / TCT TGG CAC GTG GCT TTT / Matjila et al, 2004
T. velifera / CCT ATT CTC CTT TAC GAG T / Matjila et al, 2004
T. equi / TTC GTT GAC TGC GYT TGG / Matjila et al, 2004
T. lestoquardi / ATTGCTTGTGTCCCTCCG / Ranjbar et al, 2012
T. ovis / GCATTGCTTTTGCTCCTTTA / Matjila et al, 2004
T. annae / CCG AAC GTA ATT TTA TTG ATT TG / Matjila et al, 2004
3 Results
3.1 RLB assay and evaluation of probes
PCR-RLB was performed for all the species listed in Table 2. PCR products were hybridized to the membrane and shown to bind to the specific oligonucleotide probes (Figure 1). Table 3 shows the results of the PCR-RLB.
Table 3: Reverse line blot hybridization results of Filter card samples.
Total number of collected samples / 141Number of samples positive for Ehrlichia/Anaplasma genus-specific probe / 70
Number of samples positive for Babesia genus-specific probe 2 / 2
Number of samples positive for Theileria genus-specific probe / 3
Number of samples positive for Theileria/Babesia genus-specific probe / 21
Number of samples positive for Babesia genus-specific probe 1 / 31
Number of samples positive for Babesia vogelli / 6
Number of samples positive for B. rossi / 14
Number of samples positive for Ehrlichia canis / 23
Number of samples with mixed infections / 14
Number of negative samples / 51
Table 4: Mixed infections detected in RLB assay.
Types of mixed infections detected / Number of samplesTheileria/Babesia, Ehrlichia/Anaplasma, Babesia genus-specific probe 1, B. vogelli / 4
Ehrlichia/Anaplasma, Theileria/Babesia, Babesia genus-specific probe 1, B. rossi / 3
Ehrlichia/Anaplasma, Theileria/Babesia, Babesia genus-specific probe 1, B. rossi, E. canis / 2
Ehrlichia/Anaplasma, E. canis, Babesia genus-specific probe 1 / 1
Ehrlichia/Anaplasma, Theileria/Babesia, E. canis, Babesia genus-specific probe 1 / 1
Ehrlichia/Anaplasma, Theileria catch, B. rossi / 1
Ehrlichia/Anaplasma, Theileria/Babesia / 1
Ehrlichia/Anaplasma, Babesia genus-specific probe 1, Babesia genus-specific probe 2 / 1
4. Discussion