Journal: Cellular and Molecular Life Sciences

SUPPLEMENTAL DATA

Title: Alpha synuclein elicits glucose uptake and utilization in adipocytes through the Gab1/PI3K/Akt transduction pathway

Journal: Cellular and Molecular Life Sciences.

Authors:Gerardo Rodriguez-Araujo[1], HironoriNakagami1,2, Hiroki Hayashi1, Masaki Mori1, Tetsuya Shiuchi3, Yasuhiko Minokoshi3, Yoshikazu Nakaoka5,Yoichi Takami1, Issei Komuro5, Ryuichi Morishita4, Yasufumi Kaneda1.

Affiliations:

1Division of Gene Therapy Science, 2Division of Vascular Medicine and Epigenetics, United Graduate School of Child development, 4Department of Clinical Gene Therapy, 5Department of Cardiovascular Medicine, Graduate School of Medicine, Osaka University, 2-2 Yamada-oka, Suita, Osaka, 565-0871, Japan.

3Division of Endocrinology and Metabolism, Department of Developmental Physiology, National Institute for Physiological Sciences, Okazaki, Japan.

Corresponding authors:

Hironori Nakagami, M.D., Ph.D.

Email:

And

YasufumiKaneda, M.D., Ph.D.

Email:

SupplementalMaterials and Methods

Materials

Recombinant VEGF was purchased from Peprotech. Human recombinant SNCA wild type (SNA2051) was from Atgen (South Korea). Human recombinant Insulin (Humulin R100) was purchased from Lilly and trichoroacetic acids were from NacalaiTesque, Japan. All inhibitors used were purchased from Calbiochem. Kil6425 was purchased from Cayman (USA). [1-2- 3H] 2- Deoxy-D-Glucose, 9.25MBq (for in vitro) and 37 MBq (6.25uCi/mmol, for in vivo) were purchased from Moravek. [14C] Sucrose, 37 MBq was purchased from Perkin Elmer Life & Analytical Sciences.

ELISA systems used were:Human α-Synuclein Kit (Invitrogen, USA.), Mouse Insulin ELISA Kit (Morinaga, Japan), Glucagon Kit, Duo Set (R&D, USA.) and cortisol ELISA kit (Cayman Chemical Company, USA.)

Cell Lines and Culture conditions

We maintained 3T3-L1, HepG2, C2C12, SK-N-SH and mouse primary culture cells in DMEM (Dulbecco’s Modified Eagle Medium) with 10% fetal bovine serum supplemented with penicillin-streptomycin. Stably expressing CAR (Coxsackie-Adenovirus receptor) 3T3-L1 cells were gently provided by Dr. Yoshihiro Ogawa (Tokyo Medical and DentalUniversity). Conventional 3T3-L1 and CAR 3T3-L1 cells were maintained in DMEM (Dulbecco’s Modified Eagle Medium) with 10% FBS (fetal bovine serum) and P-S (penicillin and streptomycin). Adipocyte differentiation was induced in 3T3-L1 cells using the STEMPROAdipogenesis Differentiation Kit (Invitrogen, USA) for 7 days.All cells were growth at 37°C with 5% CO2 in a cell incubator.

Cell and tissue lysates were treated with RIPA Buffer 1X (Thermo) supplemented with a protease inhibitor, 1:100 (Complete, EDTA-free, Roche). In vivo samples were homogenized at 3,000 RPM, 10 seconds, 2 times using a Multi Beads-Shocker (Yasui Kikai) and at all times kept at 4°C. Lysates were centrifuged 130,000 RPM for 10 min and protein concentration was quantified by absorbance at 700 nM by luminometer system (Berthold DLR). The samples were boiled at 98°C for 5 min with sample buffer (Laemmli Sample Buffer, Bio Rad) and finally, supernatants were run by SDS page for posterior immunoblotting.

Immunobloting and immunoprecipitation

Samples were run in multigradient gel (Multigel II Mini, Cosmo Bio). Transference was performed using PVDF transfer membranes (AmershamHybond, GE Health Care). Membranes were blocked using 5% skim milk (NacalaiTesque) in PBS-T (tween 0.05%) for 1 hr and incubated overnight with primary antibody. Then, membranes were washed with PBS-T three times and incubated with HRP linked IgG (Rabbit/Mouse, GE Health Care). Subsequent, washing with PBS-T three times was performed and then ECL plus WB detection system (GE Health Care) was added to membranes and incubated for 10 min. Later, membranes were exposed to a high performance chemiluminescence film (Amersham, GE healthcare) and then developed in a Medical Film Processor (Fuji Film) or an Image Quant LAS4000 mini (GE) using manufacturer’s manual.

For immunoprecipitation, 1X10 (1)cells were plated in 10 cm dishes. Once reached semi-confluence, cells were starved in DMEM serum free for 24 hrs. Stimulation was performed with SNCA (10 nM), insulin (200 nM) for 5 min in a cell incubator at 37°C, 5% CO2. Cells were washed once with chilled PBS and cell lysates were treated with NP40 Buffer (supplemented with a protease inhibitor). Lysates were collected in a low attachment tube at 4°C and incubated for 5 min on ice. Then, lysates were homogenized with syringe (1ml) and needle (27G 3/4”) 10 times, each sample. Lysates were centrifuged at 120,000 RPM, 10 min at 4°C and the supernatants were transferred to a new tube. Protein concentration was measured using luminometer system. Standardized samples (same protein concentration) were incubated overnight with primary antibody. Next day, Protein Sepharose G beads (GE) were added to precipitate the antibody. The precipitated was then exposed to repeated washing-centrifugation cycles with NP40 Buffer, 3 times and later boiled at 98°C for 5 min with Laemli sample Buffer (Bio-Rad). Collection of supernatants was performed and run by SDS Page for posterior immunoblotting．

Antibodies

Antibodies: 4G10 and PI3K p85-alpha were from Millipore (USA); pAkt2 (S474) and Akt2 from SAB (USA); Anti-BSA (albumin) from upstate biotechnology (USA); LPAR2 (LS-C120644) from LifeSpanBioSciences (USA); CD97 (sc-98577) from Santa Cruz (USA); all other antibodies were from Cell Signaling (USA).

PI3Kinase assay (Thin Layer Chromatography)(2)

3T3-L1 cells were plated in 10 cm dish and when 90% of confluence was reached medium was changed to DMEM (serum free) over night (8 hr). 3T3-L1 stimulation and obtention of lysates were performed as described under immunoprecipitation procedures. Primary antibody (p85, cell signaling) was added to the lysates and rotated overnight at 4°C. Next day, Protein Sepharose G beads (GE Health care) were added to precipitate the antibody. The precipitated was then exposed to repeated washing-centrifugation cycles with NP40 Buffer, 2 times. The pellet was re-suspended in 50 μL of kinase reaction buffer (20mmol/L of Tris-HCl, ph 7.5, 100mmol/L of NaCl and 0.5 mmol/L of EGTA) and mixed by tapping the tube gently. Later, 0.5 μL of 20 mg/mL of phosphatidylinositol was added and incubated at 25°C for 10 min. 5 μL of [32P] ATP 10-20 μCi in 0.1M of MgCl2 was added to samples and incubated for 30 min precisely. The reaction was stopped with 100 μL buffer containing [Chloroform: methanol: 11.6 mol/L HCl (100:200:2)]. After centrifugation 13,000 RPM for 1 min, the lower phase was extracted and 10 μL was spotted on the thin layer chromatography (TLC) silica gel plate (Whatman, Maidstone, UK). Plates were developed with a solution containing chloroform, methanol, 25% ammonium hydroxide and water (43:38:5:7). The plates were exposed to the film and incubated at -80°C overnight. The film was developed in a Medical Film Processor (Fuji Film) using manufacturer’s manual.

Gab1 siRNA

Transfection of scrambled and Gab1 siRNA [Gab1 MSS204497, Stealth; Stealth RNAi negative control, both from Invitrogen(3)] was performed in 3T3-L1 cells using Lipofectamine 2000 (Invitrogen).

0.8 X106 cells (3T3-L1) were plated in 6 well dish and incubated 24 hr in DMEM 10% FBS at 37°C, 5% CO2. Cells were washed once with PBS. Lipofection with 100 pM of specific murine Gab1 siRNA and control siRNA (scrambled) was performed and incubated for 4 hrs. Medium was changed to DMEM with FBS 10%, P-S for 24 hr. Four hr before the initiation of the experiments, the medium was changed to a serum free medium. Stimulation with SNCA 10 nM for 5 min was performed and cell lysates were extracted for immunoblotting and glucose uptake assay.

Gab1 overexpression by Adenovirus vector(3)

Briefly, 10 M.O.I. of Gab1 adenovirus or LacZ-adenovirus were transfected in sub confluent CAR-3T3-L1 cells (50-60%) and incubated 24 hr at 37°C, 5% CO2. Cells were serum starved for 24 hr and then treated with SNCA (10 nM) for 5 min. Cell lysates were obtained as described before for further immunoblotting.

Glucose uptake in vitro

Cells were seeded (1X106) in 6 well plate series and incubated with DMEM, 10% FBS, P-S at 37°C and 5% CO2 for 24 hrs. The medium was changed to DMEM serum free 24 hr more. Then, DMEM glucose and serum free medium was changed and incubated for 1 hr at 37°C, 5% CO2. SNCA (10 nM) and insulin (200 nM) were added to the cells and pre-incubated for 10 min at 37°C, 5% CO2. After that, cells were exposed to [3H] 2- deoxy-d-glucose in a concentration of 0.1 mM (0.5mCi/mL) and incubated at 37°C, 5% CO2 for 10, 20 and 30 min. Reaction was stopped by rinsing with chilled PBS four times. 5% trichloroacetic acid was poured to the cells and kept for 2 min. Later, NaOH (0.5 M) was added and incubated for 30 min at 80°C. Neutralization reaction was done by addition of 100 μL of HCl2 (36%). Cell lysates and liquid scintillation (OptiphaseSupermix, Perkin Elmer) were mixed at 1:5 dilution and measured using a Wallac 1409 Liquid Scintillation Counter for 60 seconds, each sample. Data was collected for further analysis.

GLUT 4 mobilization(4).

Briefly,we cloned GLUT4(SLC2A4) from cDNA of human aortic endothelial cells (HAEC) by polymerase chain reaction (PCR). Then, after DNA purification using QIA-quick Kit (Qiagen, USA), we inserted GLUT into a GFP expressing vector by DNA recombination (LR clonase II Invitrogen, USA). The resulting plasmid GLUT4- GFP (6 μg) was later transfected into 3T3-L1 cells using Lipofectamine 2000 (Invitrogen, USA) according with manufacturer’s instructions. Duplexes were added to the cells (6 well-dishes with glass coverslips). After 4 hr, medium was changed to DMEM 10% FBS P-S and cells were kept 24 hr more. Next, cells were serum starved at 37°C, 5% CO2 for 24 hr. After that, treatment with SNCA (10 nM) or insulin (200 nM) for 5 min was performed. Later, plates were placed on ice and washed once with chilled PBS. Cells were then fixed with paraformaldehyde (PFA) 4% in PBS for 15 min at room temperature. Cells attached to the glass coverslips were washed with PBS once. Mounting was performed using Prolong Gold AntifadeReagent (Invitrogen, USA). Samples were dried for 10 min and immediately visualized with a Confocal Microscope Radiance 2100 Laser Scanning System (Bio Rad, USA). Pictures were taken with a Nikon Eclipse TE2000-U system (USA).

Primer / Sequence ( 5’ - 3’ )
Human GLUT4 Forward Nested / CTCCAGGATCGGTTCTTTCA
Human GLUT4 Reverse Nested / CTCCTGTCCTGCTCTCTGCT
Human GLUT4 Forward / CACCATGCCGTCGGGCTTCCAACACAGATA
Human GLUT4 Reverse / TCAGTCGTTCTCATCTGGCCCTAAATAC

Animal procedures

Twelve week old male C57/BL6 (WT) and SNCAKO mice were handled in compliance with Osaka University’s Animal Facility regulations. They were conserved under light-dark, no pathogen but non sterile conditions. For group comparisons, in all experiments we used mice under same body weight (25±1 g) and fed ad libitum with standard chow.

For immunoblot analysis of tissues, SNCA 14 μg/Kg was injected intravenously (I.V.). After 5 min, tissues were extracted rapidly, weighted and frozen in liquid nitrogen. Tissues were homogenized and lysed for posterior running by SDS page. Insulin, glucagon and cortisol determination by ELISA system was performed in compliance with manufacturer’s instructions. Data was collected and analyzed.

Glucose uptake in vivo (1)

Mice were previously submitted to cardiac catheter installation and habituated to handling for 3 days previously. Mice were fasted for 5 hr before the experiment. Then, under euglycemic conditions, SNCA 14 μg/kg or insulin 0.8 IU/kg in 20% glucose (total volume, 100 μL) were infused through cardiac catheter and incubated for 10 min. 6.25 μCi of [3H] 2 deoxy-d-glucose and 1.25 μCi of [14C] sucrose in 50 μl of saline were infused, respectively. Catheter was flushed after every infusion (100 μL) and after obtaining blood samples (50 μL). Then, blood samples (BS) were taken at 0, 7, 10, 15 and 20 min to create a tritium-sucrose disappearance standard curve. BS were mixed with NaOH, boiled at 80°C for 1 hr and neutralized with 100 μL of HCl2. BS were centrifuged at 130,000 RPM for 10 min and placed in LSC vial. After the extraction the last BS, tissues were extracted, weighted (50 mg) and placed into LSC vial. 100 μL of organic solvent (Solvable, Perkin Elmer) was added to the LSC vial and boiled at 80°C for 2.5 hrs. Scintillation liquid (Ultima Gold, Perkin Elmer) was added to the LSC vial (Tissues and blood samples). Scintillation counting was performed using a Wallac 1409 Liquid Scintillation Counter for 60 seconds, each sample. Tissue’s constant rate was obtained using the logarithm of the tritium-sucrose disappearance standard curve.

GPCR screening.

We comprehensively silenced the 379 human genes encoding G coupled receptors using the Silencer Select GPCR siRNA Library V4 from Ambion (USA). Briefly, we transfected 5 nM of siRNA to HEK293 and SK-N-SH cells using RNAiMAX according with manufacturer’s instructions using poly-D-lysine 96 well plates (BD BioCoat, USA). After 24 hr transfection, cells were serum starved for 1 day more and then stimulated with SNCA 10 nM or insulin 100 nM for 5 min. We used an in-well lysis buffer, M-PER Mammalian Protein Extraction Reagent (Thermo, USA), supplemented with a protease inhibitor, 1:100 (Complete, EDTA-free, Roche). Phosphorylation of Akt was assessed using PathScanPhospho Akt1 (S473) ELISA kit from Cell Signaling. We used three different siRNAs for each gene and repeated three times to obtain consistent data. Our data was later analyzed looking for smallest differences between treated and non-treated groups in the 3 independent experiments. Results were then compared and re-tested with respective controls and different cell lines. We used mouse stealth siRNA LPAR2 (s79393, s79394, s79395) and CD97 (s76982, s76983) from Applied Biosystems (USA) to transfect into 3T3-L1 cells. Results were confirmed using immunoblot analysis.

Software and Data Analysis.

In vivo and in vitro data was statistically analyzed using Stat View v5.0. We presented data as means ± s.d. We used student’s t test and ANOVA analysis for statistical significance. Bonferroni’s test was used for multiple comparisons when appropriate. Immunoblottings, pictures, and microphotographs were analyzed or visualized with Adobe Photoshop 7.0.1, Image J v1.37c and Adobe Illustrator CS5.

Supplemental References.

1.Shiuchi, T., Haque, M.S., Okamoto, S., Inoue, T., Kageyama, H., Lee, S., Toda, C., Suzuki, A., Bachman, E.S., Kim, Y.B., et al. 2009. Hypothalamic orexin stimulates feeding-associated glucose utilization in skeletal muscle via sympathetic nervous system. Cell Metab 10:466-480.

2.Hayashi, H., Nakagami, H., Takami, Y., Koriyama, H., Mori, M., Tamai, K., Sun, J., Nagao, K., Morishita, R., and Kaneda, Y. 2009. FHL-2 suppresses VEGF-induced phosphatidylinositol 3-kinase/Akt activation via interaction with sphingosine kinase-1. Arterioscler Thromb Vasc Biol 29:909-914.

3.Koyama, T., Nakaoka, Y., Fujio, Y., Hirota, H., Nishida, K., Sugiyama, S., Okamoto, K., Yamauchi-Takihara, K., Yoshimura, M., Mochizuki, S., et al. 2008. Interaction of scaffolding adaptor protein Gab1 with tyrosine phosphatase SHP2 negatively regulates IGF-I-dependent myogenic differentiation via the ERK1/2 signaling pathway. J Biol Chem 283:24234-24244.

4.Oatey, P.B., Van Weering, D.H., Dobson, S.P., Gould, G.W., and Tavare, J.M. 1997. GLUT4 vesicle dynamics in living 3T3 L1 adipocytes visualized with green-fluorescent protein. Biochem J 327 ( Pt 3):637-642.

1

[1]