A Microarray Analysis of the Effects of Moderate Hypothermia and Re-Warming on Gene Expression

A microarray analysis of the effects of moderate hypothermia and re-warming on gene expression by human hepatocytes (HepG2)

Larry A. Sonna, Matthew M. Kuhlmeier, Purvesh Khatri,

Dechang Chen, and Craig M. Lilly

Supplemental Materials

SUPPLEMENTAL MATERIALS AND METHODS

Cell Culture

Human hepatocytes (hepatocellular carcinoma HepG2) were obtained from the American Type Culture Collection (ATCC, Catalog Number HB-8065) and were grown in 25 cm2 vented culture flasks containing 5 mL of media composed of Minimum Essential Medium Eagle (ATCC, Catalog Number 30-2003) supplemented with 10% Fetal Bovine Serum (Gibco/Invitrogen), and 2% Penicillin-Streptomycin (Gibco/Invitrogen) in a 5% CO2, 37oC tissue culture incubator. The cells were grown to 90 – 95% confluence prior to exposure to thermal stress conditions.

Heat and Cold Exposure

Cells were grown to subconfluence as described above. Four hours prior to the beginning of the experiment, media was replaced with fresh, pre-warmed serum-free media and allowed to equilibrate at 37oC. Thermal stresses were delivered by placing flasks into thermostatic water baths (Daigger Catalog Number MX22581B) contained within tissue incubators (NAPCO Model 5430 for control and heat shock conditions; REVCO ULTIMA Model RCO3000 for moderate hypothermia). Both the tissue culture incubators and the water baths used to deliver thermal stress were maintained at the desired temperatures (31oC for cold shock, 43oC for heat shock). Control cells were maintained in a 37oC incubator. Temperatures in the water baths and in the control incubator were monitored with a mercury thermometer. Because each transfer of cells to and from control conditions involved moving flasks from one incubator to another, both the control cells and the thermally stressed cells were exposed to the same transient alterations in ambient conditions that occur when the door to a 5% CO2 incubator is opened. In a preliminary experiment, we found that our experimental setup allowed us to reach the desired exposure temperatures inside the culture flasks within the following times: Control (37oC) to cold (31oC), 30 minutes; control to heat (43oC), 4 minutes; return from cold to control, 10 minutes; return from heat to control, 12 minutes.

The thermal stress conditions tested were 31oC for 16 hours (moderate hypothermia) or 37oC for 15.5 hours, followed by 43oC for 0.5 hours (heat shock), or 37oC for 16 hours (control). The hypothermic exposure time was chosen based on preliminary experiments in HepG2 cells that confirmed literature observations, made in other cell lines (21;22), that increased expression of CIRBP as a result of moderate hypothermia (30 – 32oC) requires 12 to 24 hours of exposure to cold. The heat shock conditions were experimentally conventional (6oC over normal culture temperatures for 30 minutes) and we have previously reported that they produce a vigorous heat shock response in HepG2 cells (27). The time point at which cells were removed from thermal stress conditions was defined at time zero (T=0). Cells were studied at time zero, or allowed to recover at 37oC for either 3 hours (microarray experiments) or for 1, 3 and 6 hours (qualitative confirmatory reverse-transcription PCR experiments).

RNA Extraction

At each time point, the culture media was aspirated off, the cells were briefly rinsed once with cold 1% phosphate buffered saline, 5 mL of pre-heated Trypsin solution (Gibco, Catalog Number 25200-056) was added to facilitate the removal of the cells from the flask, and the flasks were then returned to the control incubator for several minutes to allow time for the cells to detach from the flask. The trypsin was inactivated by addition of 5 mL of MEME, and Trypan Blue Exclusion measurement of cell viability was performed on an aliquot of the resulting cell suspension.

Extracted cells were then pelleted by centrifugation, and total RNA was extracted using the Qiagen RNeasy Mini Kit (Qiagen, Catalog Number 74104). RNA quality was assessed by spectrophotometry and by examination of an aliquot of RNA by gel electrophoresis. All samples analyzed met prospectively defined quality criteria (8;29), specifically, an OD260/OD280 ratio of at least 1.8, a minimum yield of 25 micrograms per sample, sharp 18S and 28S bands on an RNA gel, and no spurious peaks in the absorption spectrum in the range 230 nm – 320 nm.

Additionally, each sample set submitted for microarray analysis was required to demonstrate appropriate differential expression of well established positive control genes (CIRBP for samples subjected to moderate hypothermia, HSP70B’for heat shocked samples) and stable expression of a control gene (Cyclophilin A).

DNA Microarray Analysis

Expression analysis was performed using Affymetrix Gene ChipTM U133A arrays, containing approximately 22,283 sequences. Hybridization to the arrays was performed per the manufacturer’s instructions, as described in detail elsewhere (29). Pre-processing was performed using MAS 5.0 software, with the clipped average signal intensity set to 500. Signal intensity at each condition/ time point represented the data input used for the statistical analysis described below.

Statistical Analysis

Statistical analyses were performed using SPSS version 10, R version 1.9, and a 2-way repeated measures software algorithm that was written in Java and whose output was verified by comparison to that of SPSS(14).

Sequences that had a statistically significant change in expression were identified by 2-way, repeated measures ANOVA performed on the signal intensities reported by the MAS 5.0 software. Time and exposure condition (heat, control, or cold) were the two factors involved in the ANOVA. Gene expression during recovery from thermal stress was not assumed to be independent of the level of expression that occurs during thermal exposure (28); accordingly, time was treated as a repeated measures factor. A P value of 0.05 or less was taken as an indication of statistical significance.

To identify the source of the differences detected by 2-way ANOVA, the sequences that demonstrated a statistically significant main effect of exposure condition or a statistically significant interaction between time and exposure condition were then subjected to further analysis as follows. Signal intensities at each time point (at the end of exposure and 3 hours into recovery) were analyzed separately by 1-way ANOVA with exposure condition as the grouping factor. For sequences that displayed homogeneity of variance as defined by Levene’s test (using means as the basis for computing residuals and concluding that homogeneity of variance was present if the P value was greater than 0.05), ANOVA was performed using the equal variance assumption with the R statistical package. For sequences that did not display homogeneity of variance, the Oneway procedure in R was used, which does not assume equal variance. Post-hoc multiple group comparisons were then performed with SPSS using Tukey’s HSD for sequences that met the equal variance assumption and Dunnett’s C for sequences that did not.

The purpose of this study was to identify gene expression sequences that were affected by thermal stress. Accordingly, sequences were excluded from consideration if their signal intensities showed a statistically significant change over time that was entirely independent of thermal exposure condition (i.e., no main effect of exposure condition and no interactive effect between time and exposure condition). Only 5.7% of sequences (see results section) were excluded based on this criterion.

Additionally, where noted in this manuscript, we excluded sequences from further consideration if they did not demonstrate a 2-fold or greater change in expression at one or both of the time points studied. Because of the extensive post-hoc filtering already implicit in this statistical approach, we did not use MAS 5.0 expression calls to further filter the data.

Ontological Analysis

We performed ontological analysis of the genes affected by thermal stress by both manual and computer-assisted methods. In the first method, which has been used by our laboratory in previous work, each sequence was assigned a functional class manually using resources available at the NCBI web site ( such as Entrez Gene and Online Mendelian Inheritance in Man. These functional assignments were used to create the tables in this manuscript and to identify classes of genes that were looked at specifically for effects of thermal stress (such as housekeeping genes and HSPs).

In the second method, which was used in specific instances as reported in the manuscript, we used Onto-Express (7;15) to look for functional categories specifically affected by hypothermia and heat shock. In this analysis, we included all sequences affected by each combination of temperature and time, regardless of the magnitude of the change. Because the possibility that the conditions at T=0 and T=3 were biologically different (e.g., cooling vs. re-warming and heat shock vs. recovery), the lists of genes for each time point and condition were submitted separately to Onto-Express in order to see the biological processes/molecular functions most affected by each combination. Additionally, because it is unknown whether the mechanisms responsible for increases in gene expression are the same as those responsible for decreases in expression, we submitted the lists of increased and decreased genes separately.

Onto-Express assigns Gene Ontology Annotations (EBI, the European Bioinformatics Institute) (1) to each sequence significantly affected by the stress of interest and to each sequence represented on the microarray. It then looks for functional categories that are statistically overrepresented by the stressor of interest. In our Onto-Express analysis, we instructed the software to use the default database for GOA assignments (Ont-Tools), FDR correction for multiple comparisons, and a hypergeometric distribution in the analysis. Because we were interested in a side-by-side comparison of genes affected immediately after thermal stress (T=0) and after recovery at 37oC (T=3 hours), a corrected P value of 0.025 or less was considered statistically significant.

Confirmation of Key Findings by Reverse Transcription PCR

Poly-T primed reverse transcription PCR was performed using the Retroscript First-Strand Synthesis Kit (Ambion, Austin, TX), following the manufacturer’s instructions. 4 g of RNA per sample was used for each reaction. After reverse transcription, samples were diluted to a concentration of 50ng/L and further amplified by conventional PCR as described previously (27;29) using Taq polymerase and buffers obtained from Promega (Madison, WI). The primer sequences used in these reactions are listed in Supplemental Table 1.

Supplemental Table 1. Primer sequences used in this study

Name of Primer / GenBank Number / Sense Sequence / Anti-Sense Sequence / Tm (oC) / Amplicon size (bp)
Cyclophilin A / BC018843 / aggtcccaaagacagcagaa / tgtccacagtcagcaatggt / 60 / 406
CIRBP / D78134 / ctgctcaagatcgtccttcc / ggattcacagtccgttcgat / 60 / 401
HSP70B’ / X51757 / tgcccgcctatttcaatg / cccccaccaggacgac / 61 / 579
NYBR-20 / AA886335 / aacccaatggcaaagtgaag / gccatctctcccaagtgaag / 61 / 159
CRIPT / NM_014171 / gggagtgaggggagaaatgt / gcaccaaccaggttctcatt / 57 / 504
HSPC-159 / NM_014181 / agtgatgggcatcgtagacc / tggcacgtgatcctatttga / 60 / 392
Phospholipid Scramblase 4 / NM_020353 / ttctgtctgcctgccttttt / gagacacagcaagccatcaa / 60 / 490
PCK-1 / NM_002591 / gagagaactccagggtgctg / gaacacttgccctctcttgc / 60 / 360
CYP4-F2 / D26480 / ggagctcagtgcccttgtat / caatgtcctgggtgacatgg / 57 / 542
NUP-160kD / AK026236 / tgtagtgctggagcgatgtc / ccatgctcagttcccattct / 57 / 502

Supplemental Table 2, continued. Effects of moderate hypothermia and heat shock on expression of negative control sequences

P values

/ Expression Ratios
(Stress / Control)
Geometric Mean, N=6
2-way RM ANOVA / 1-way ANOVA
Common Name(s) / Identifier / Main effect
(Cold, Control,
Heat) / Interaction (Condition*Time) / Shock (T=0) / Recovery (T=3) / Cold shock (T=0) / Cold recovery (T=3) / Heat shock (T=0) / Heat recovery (T=3)
Beta actin
Sequence from 3' region / X00351 / 0.001 / 0.639 / 0.007 / 0.012 / 1.18* / 1.21* / 1.15* / 1.11
Sequence from 5' region / X00351 / 0.008 / 0.840 / 0.006 / 0.091 / 1.20* / 1.16 / 1.13 / 1.11
Sequence from middle region / X00351 / 0.015 / 0.962 / 0.028 / 0.065 / 1.20* / 1.18 / 1.15 / 1.16
Glyceraldehyde 3-phosphate dehydrogenase (GAPDH)
Sequence from 5' region / M33197 / 0.011 / 0.494 / 0.045 / 0.018 / 1.02 / 1.11 / 1.17 / 1.22*
Sequence from 3' region / M33197 / 0.011 / 0.984 / 0.022 / 0.089 / 1.06 / 1.06 / 1.22* / 1.22
Sequence from middle region / M33197 / 0.022 / 0.587 / 0.027 / 0.064 / 1.01 / 1.05 / 1.20* / 1.17

Ribosomal Proteins

RPL30 / L05095 / 0.035† / 0.832 / 0.098 / 0.172 / 1.03 / 1.00 / 1.17 / 1.12
RPL41 / NM_021104 / 0.055 / 0.938 / 0.049† / 0.208 / 1.04 / 1.05 / 1.19 / 1.22
RPL13A / BC001675 / 0.089 / 0.962 / 0.119 / 0.175 / 1.07 / 1.04 / 1.20 / 1.16
BF942308 / 0.155 / 0.773 / 0.305 / 0.191 / 1.00 / 1.06 / 1.11 / 1.17
RPL37A / NM_000998 / 0.067 / 0.531 / 0.231 / 0.140 / 1.02 / 1.09 / 1.12 / 1.26
RPL38 / AW303136 / 0.849 / 0.891 / 0.726 / 0.978 / 1.08 / 1.09 / 0.92 / 1.06
RPLP1; Ribosomal protein, large, P1 / NM_001003 / 0.362 / 0.438 / 0.175 / 0.699 / 1.03 / 0.99 / 1.16 / 1.07
RPS10 / NM_001014 / 0.267 / 0.498 / 0.220 / 0.378 / 1.10 / 0.99 / 1.17 / 1.11
RPS12 / AI799007 / 0.133 / 0.899 / 0.339 / 0.152 / 1.03 / 1.05 / 1.12 / 1.16
RPS2 / NM_002952 / 0.067 / 0.726 / 0.195 / 0.145 / 1.03 / 1.07 / 1.15 / 1.23
AI183766 / 0.062 / 0.772 / 0.081 / 0.242 / 0.99 / 1.06 / 1.15 / 1.23
RPS20 / NM_001023 / 0.305 / 0.974 / 0.357 / 0.404 / 1.05 / 1.06 / 1.11 / 1.11
RPS23 / NM_001025 / 0.084 / 0.915 / 0.146 / 0.200 / 1.04 / 1.01 / 1.15 / 1.16
RPS29 / NM_001032 / 0.356 / 0.302 / 0.153 / 0.671 / 1.03 / 1.05 / 1.17 / 1.10
RPS3 / U14990 / 0.080 / 0.882 / 0.062 / 0.170 / 0.98 / 0.97 / 1.16 / 1.12
RPS3A / NM_001006 / 0.181 / 0.831 / 0.095 / 0.340 / 0.98 / 1.02 / 1.14 / 1.19

Other

PPIA; Peptidylprolyl isomerase A; Cyclophilin A / NM_021130 / 0.108 / 0.655 / 0.275 / 0.102 / 1.07 / 1.12 / 1.09 / 1.13
Human Alu-Sq subfamily consensus sequence / U14573 / 0.114 / 0.779 / 0.205 / 0.252 / 0.98 / 1.01 / 1.14 / 1.22
Transcribed sequence with strong similarity to protein pdb:2RMA (H.sapiens) S Chain S, Cyclophilin A / BE731738 / 0.158 / 0.493 / 0.513 / 0.100 / 1.06 / 1.13 / 1.08 / 1.16

*Difference between stressed cells and control cells was statistically significant, P 0.05

† Statistically significant, but source of difference could not be identified by post-hoc analysis

Supplemental Table 3, continued. Definitions of functional categories

Functional category / GO number / GO Definition
Androgen receptor signaling pathway / GO:0030521 / Any series of molecular signals generated as a consequence of an androgen binding to its receptor.
Anti-apoptosis / GO:0006916 / A process which directly inhibits any of the steps required for cell death by apoptosis.
Carbohydrate metabolism / GO:0005975 / The chemical reactions and pathways involving carbohydrates, any of a group of organic compounds based of the general formula Cx(H2O)y.
Cell cycle / GO:0007049 / The progression of biochemical and morphological phases and events that occur in a cell during successive cell replication or nuclear replication events. Canonically, the cell cycle comprises the replication and segregation of genetic material followed by the division of the cell, but in endocycles or syncytial cells nuclear replication or nuclear division may not be followed by cell division.
Cell division / GO:0051301 / The process resulting in the physical partitioning and separation of a cell into daughter cells.
Cell migration / GO:0016477 / The orderly movement of cells from one site to another, often during the development of a multicellular organism.
Chromosome organization and biogenesis / GO:0007001 / A process that is carried out at the cellular level that results in the formation, arrangement of constituent parts, or disassembly of chromosomes, structures composed of a very long molecule of DNA and associated proteins that carries hereditary information.
DNA repair / GO:0006281 / The process of restoring DNA after damage. Genomes are subject to damage by chemical and physical agents in the environment (e.g. UV and ionizing radiations, chemical mutagens, fungal and bacterial toxins, etc.) and by free radicals or alkylating agents endogenously generated in metabolism. DNA is also damaged because of errors during its replication. A variety of different DNA repair pathways have been reported that include direct reversal, base excision repair, nucleotide excision repair, photoreactivation, bypass, double-strand break repair pathway, and mismatch repair pathway.
DNA replication / GO:0006260 / The process whereby new strands of DNA are synthesized. The template for replication can either be an existing DNA molecule or RNA.
Endocytosis / GO:0006897 / The uptake of external materials by cells by the invagination of small region of the plasma membrane to form a new intracellular membrane-limited vesicle.
Epidermis development / GO:0008544 / The process whose specific outcome is the progression of the epidermis over time, from its formation to the mature structure. The epidermis is the outer epithelial layer of a plant or animal, it may be a single layer that produces an extracellular material (e.g. the cuticle of arthropods) or a complex stratified squamous epithelium, as in the case of many vertebrate species.
ER to Golgi vesicle-mediated transport / GO:0006888 / The directed movement of substances from the endoplasmic reticulum (ER) to the Golgi, mediated by COP II vesicles. Small COP II coated vesicles form from the ER and then fuse directly with the cis-Golgi. Larger structures are transported along microtubules to the cis-Golgi.
Fatty acid metabolism / GO:0006631 / The chemical reactions and pathways involving fatty acids, aliphatic monocarboxylic acids liberated from naturally occurring fats and oils by hydrolysis.
Glycolysis / GO:0006096 / The chemical reactions and pathways resulting in the breakdown of a monosaccharide (generally glucose) into pyruvate, with the concomitant production of a small amount of ATP. Pyruvate may be converted to ethanol, lactate, or other small molecules, or fed into the TCA cycle.
G-protein coupled receptor protein signaling pathway / GO:0007186 / The series of molecular signals generated as a consequence of a G-protein coupled receptor binding to its physiological ligand.
Intracellular protein transport / GO:0006886 / The directed movement of proteins in a cell, including the movement of proteins between specific compartments or structures within a cell, such as organelles of a eukaryotic cell.
Intracellular signaling cascade / GO:0007242 / A series of reactions within the cell that occur as a result of a single trigger reaction or compound.
Lipid metabolism / GO:0006629 / The chemical reactions and pathways involving lipids, compounds soluble in an organic solvent but not, or sparingly, in an aqueous solvent. Includes fatty acids; neutral fats, other fatty-acid esters, and soaps; long-chain (fatty) alcohols and waxes; sphingoids and other long-chain bases; glycolipids, phospholipids and sphingolipids; and carotenes, polyprenols, sterols, terpenes and other isoprenoids.
Metabolism / GO:0008152 / The chemical reactions and pathways, including anabolism and catabolism, by which living organisms transform chemical substances. Metabolic processes typically transform small molecules, but also include macromolecular processes such as DNA repair and replication, and protein synthesis and degradation.
Mitosis / GO:0007067 / Progression through mitosis, the division of the eukaryotic cell nucleus to produce two daughter nuclei that, usually, contain the identical chromosome complement to their mother.
mRNA export from nucleus / GO:0006406 / The directed movement of mRNA from the nucleus to the cytoplasm.
mRNA processing / GO:0006397 / Any process involved in the conversion of a primary mRNA transcript into one or more mature mRNA(s) prior to translation into polypeptide.
mRNA splice site selection / GO:0006376 / Selection of a splice site by components of the assembling spliceosome.
Negative regulation of progression through cell cycle / GO:0045786 / Any process that stops, prevents or reduces the rate or extent of progression through the cell cycle.
Nuclear mRNA splicing, via spliceosome / GO:0000398 / The joining together of exons from one or more primary transcripts of nuclear messenger RNA (mRNA) and the excision of intron sequences, via a spliceosomal mechanism, so that mRNA consisting only of the joined exons is produced.
Nucleosome assembly / GO:0006334 / The aggregation, arrangement and bonding together of a nucleosome, the beadlike structural units of eukaryotic chromatin composed of histones and DNA.
Protein biosynthesis / GO:0006412 / The chemical reactions and pathways resulting in the formation of a protein. This is a ribosome-mediated process in which the information in messenger RNA (mRNA) is used to specify the sequence of amino acids in the protein.
Protein folding / GO:0006457 / The process of assisting in the covalent and noncovalent assembly of single chain polypeptides or multisubunit complexes into the correct tertiary structure.
Protein import into nucleus, docking / GO:0000059 / The aggregation, arrangement and bonding together of the nuclear localization signal of a protein with nuclear envelope proteins such as importins.
Protein modification / GO:0006464 / The covalent alteration of one or more amino acids occurring in proteins, peptides and nascent polypeptides (co-translational, post-translational modifications). Includes the modification of charged tRNAs that are destined to occur in a protein (pre-translation modification).
Protein transport / GO:0015031 / The directed movement of proteins into, out of, within or between cells.
Regulation of progression through cell cycle / GO:0000074 / Any process that modulates the rate or extent of progression through the cell cycle.
Regulation of transcription from RNA polymerase II promoter / GO:0006357 / Any process that modulates the frequency, rate or extent of transcription from an RNA polymerase II promoter.
Regulation of transcription, DNA-dependent / GO:0006355 / Any process that modulates the frequency, rate or extent of DNA-dependent transcription.
Regulation of translational initiation / GO:0006446 / Any process that modulates the frequency, rate or extent of translational initiation.
Response to stress / GO:0006950 / A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of a disturbance in organismal or cellular homeostasis, usually, but not necessarily, exogenous (e.g. temperature, humidity, ionizing radiation).
Response to unfolded protein / GO:0006986 / A change in state or activity of a cell or an organism (in terms of movement, secretion, enzyme production, gene expression, etc.) as a result of an unfolded protein stimulus.
RNA processing / GO:0006396 / Any process involved in the conversion of one or more primary RNA transcripts into one or more mature RNA molecules.
RNA splicing / GO:0008380 / The process of removing sections of the primary RNA transcript to remove sequences not present in the mature form of the RNA and joining the remaining sections to form the mature form of the RNA.
rRNA processing / GO:0006364 / Any process involved in the conversion of a primary ribosomal RNA (rRNA) transcript into one or more mature rRNA molecules.
Signal transduction / GO:0007165 / The cascade of processes by which a signal interacts with a receptor, causing a change in the level or activity of a second messenger or other downstream target, and ultimately effecting a change in the functioning of the cell.
Transcription / GO:0006350 / The synthesis of either RNA on a template of DNA or DNA on a template of RNA.
Transcription initiation from RNA polymerase II promoter / GO:0006367 / Any process involved in starting transcription from the RNA polymerase II promoter.
Tansport / GO:0006810 / The directed movement of substances (such as macromolecules, small molecules, ions) into, out of, within or between cells.
Ubiquitin cycle / GO:0006512 / Accession number is no longer in GO
Ubiquitin-dependent protein catabolism / GO:0006511 / The chemical reactions and pathways resulting in the breakdown of a protein or peptide by hydrolysis of its peptide bonds, initiated by the covalent attachment of a ubiquitin moiety, or multiple ubiquitin moieties, to the protein.