Supplementary materials
Table S1. The primer sequences of real-time RT-PCR
Primer names / Sequences (5’→3’)SlActin / F:CCACGAGACTACATACAA
R:TACCACCACTGAGCACAA
SlHO1 / F:CTAAGGAAGGGGAAAAAGAG
R:TTTGCTATCCACCAAGAACT
SlCYCD3;1 / F:GGTCATTGCTTACTATGGCT
R:AAAAGGGGAACTTGGGTCTC
SlCDKA1 / F:CACGAACGGCGATTT
R:ACGGAGTATTTGATACAAGA
SlCYCA2;1 / F: TTGATTGGCTTGTGGAGGT
R:GTAATGCTCAGAAAGGAACCTAT
SlCYCA3;1 / F:TGCGGTTCTTGCCATCA
R:CGCCCAGTTGCTTCCA
SlRSI-1 / F:TGTTCTTGATTTTGCTCAC
R:TTTGTTGCCATAAACTCCT
SlARF7 / F:GGCGTAATCTTCAGGTAGG
R:ACTTGGCTGCTTAGGAAAC
Materials and methods
Plant material and growth conditions
Arabidopsis thaliana (Col-0) seeds, including wild-type (WT), hy1-100 (CS236) and nia1/2 (CS2356) were surface-sterilized and rinsed for four times with distilled water, then cultured in petri dishes on solid half-strength Murashige and Skoog (MS) medium (pH 5.8) with 1% (w/v) sucrose. Plates containing seeds were kept at 4ºC for 2 days, and then transferred into a growth chamber with a 16/8 h (23/18ºC) day/night regime and 150 μmol m-2s-1 irradiation.
Uniform five-day-old seedlings were transferred to homogenous mediums containing indicated chemicals for another 5 days. Afterwards, the photographs were taken. Lateral root (LR) number and density (LRs number/cm primary root; only emerged and visible LRs were included) covering the whole primary root were determined using Image J software.
Fig. S1
Fig. S1.Effects of SNP, β-CD, hemin, GSNO and β-CDH on LR formation. Three-day-old tomato seedlings were incubated with the indicated concentrations of SNP, β-CD, hemin, GSNO and β-CDHfor 4 days. Afterwards, the number of emerged LRs (>1 mm) per seedling and the emerged LR densitywere analyzed. Mean and SE values were calculated from at least three independent experiments(n=45). Within each set of experiments, bars denoted by the same letter did not differ significantly at P < 0.05according to Duncan’s multiple test
Fig. S2
Fig. S2.Effects ofβ-CDH,hemin, CO, BR, Fe-EDTA, β-CD, SNP, Old SNP,NONOate, and Old NONOateon LR formation. Three-day-old tomato seedlings were incubated with 1 nMβ-CDH, 10μΜhemin, 30% saturated CO aqueous solution, 10μΜ BR, 10μΜFe-EDTA (Fe2+), 500 nMβ-CD, 200 μΜ SNP, 200 μΜ Old SNP,100 μΜ NONOate, or 100 μΜ Old NONOatefor 4 days. Afterwards, the number of emerged LRs (>1 mm) per seedling and the emerged LR densitywere analyzed. Mean and SE values were calculated from at least three independent experiments (n=45). Within each set of experiments, bars denoted by the same letter did not differ significantly at P < 0.05according to Duncan’s multiple test
Fig. S3
Fig. S3.LR formationin response to β-CDH and GSNO. Five-day-old wild-type (WT), nia1/2and hy1-100mutant seedlings were incubated with or without200 μΜ GSNOor1 nM β-CDH. After 5 days of treatments, corresponding photographs were taken (a). Bar = 1 cm. Meanwhile, the number of emerged LRs (>1 mm) per seedling (b) and the emerged LR density (c) were calculated (n=20). Mean and SE values were calculated from at least three independent experiments. Within each set of experiments, bars denoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple test
Fig. S4
Fig. S4.Effects ofβ-CDH, SNP, ZnPP and PTIO onSlRSI-1 andSlARF7transcripts. Three-day-old tomato seedlings were incubated with H2O, 1 nMβ-CDH, 200 μΜ SNP, 50 μΜ ZnPP, 200 μΜ PTIO alone or their combinationsfor 12 h. Afterwards, the amount of correspondingtranscripts was analyzed by real-time RT-PCR, and presented relative to the control sample. Mean and SE values were calculated from three independent experiments.Within each set of experiments, barsdenoted by the same letter did not differ significantly at P < 0.05 according to Duncan’s multiple test
