ZEB2 Expression in the Epidermis Compromises the Integrity of the Epidermal Barrier Through

ZEB2 expression in the epidermis compromises the integrity of the epidermal barrier through the repression of different tight junction proteins

Marianthi N. Tatari1,2, Bram De Craene1,2, Bieke Soen1,2, Joachim Taminau1,2, Petra Vermassen1,2, Steven Goossens2,3, Katharina Haigh2,3, Silvia Cazzola4, Jo Lambert5,Danny Huylebroeck4, Jody J. Haigh2,3, Geert Berx1,2†

1Unit of Molecular and Cellular Oncology, Inflammation Research Center, VIB, 9052 Ghent, Belgium

2Department of Biomedical Molecular Biology, Gent University, 9052 Ghent, Belgium

3Unit of Vascular Cell Biology, Inflammation Research Center, VIB, 9052 Ghent, Belgium

4Laboratory of Molecular Biology (Celgen), Department of Development and Regeneration, Research Unit Embryo and Stem Cells, Faculty of Medicine, University of Leuven (KU Leuven), 3000 Leuven, Belgium

5Department of Dermatalogy 2K4, Ghent University Hospital, De Pintelaan 185, 9000 Ghent, Belgium

†Corresponding author:

Prof. Dr. Geert Berx

Unit of Molecular and Cellular Oncology

Inflammation Research Center

VIB

Technologiepark 927

B-9052 Ghent (Zwijnaarde)

Belgium

Tel.: +32 9 331 3660; fax: +32 9 331 36 09

Email address:

Supplementary material

Genotyping PCRs and Southern analysis.The ROSA26-Zeb2tg/tg mice were generated as described previously (Nyabi et al., 2009). The G4 ES cell line was used to generate the mice and the verification of the targeting of the ROSA26 locus was performed by Southern blot analysis (Figure 1b) as previously described (Nyabi et al., 2009). The genotype of the generated mice was further verified by PCR on tail genomic DNA. The recombination event was also confirmed by PCR with primers flanking the floxed-STOP cassette (Figure 1a and c). The sequences of the primers and the size of the products are given in Supplementary Table S2.

Immunohistochemical analysis.Antigens were unmasked in a 2100-Retriever (PickCell Laboratories) in different buffers, depending on the antibodies used. For antibodies against E-cadherin, β-catenin, Claudin-1, Claudin-3, Claudin-4, Filaggrin, Involucrin, Keratin-1, Keratin-14, Ki67, Loricrin or ZEB2, antigens were unmasked in 10 mM citrate buffer (pH 6.0). For antibodies against Desmoplakin and Plakophilin-1, an EDTA buffer (pH 9.0) was used. Analysis for Claudin-4 was done on fresh cryosections. For the DAB detection, we used biotinylated secondary antibodies (Dako), whereas for immunofluorescent detection, we used Alexa-coupled secondary antibodies (Molecular Probes, Invitrogen). Detection in human samples was done with AEC (Dako). Occludin and ZO-1, were analyzed in fresh cryosections followed by ethanol/acetone fixation.

RNA isolation and qRT-PCR analysis.Total RNA was extracted using Trizol according to the manufacturer’s instructions with one modification; absolute ethanol was used in place of isopropanol and the RNA precipitation was performed in -20oC over night. For the qRT-PCR analysis cDNA synthesis was performed on 1μg of total RNA using the iScript synthesis kit (BIORAD). The qRT-PCR for every gene was performed on 20ng of cDNA in triplicate on a LightCycler®480 Real-time PCR System (Roche). For ZEB2 a specific probe was used at a final concentration of 5μM together with gene-specific primers for the qRT-PCR analysis. The same probe was used for mouse-specific and human-specific ZEB2 with different primer pairs. All quantification data were normalized against 2 reference genes, HMBS and TBP, and are depicted compared to a reference sample which is set to 1. The sequences of the primers and probes used for the qRT-PCR analysis are given in Supplementary Table S4.

Cell Culture.The generation of the A431-ZEB2 cell line has been described elsewhere (Mejlvang et al., 2007). The A431-ZEB2 and the MCF7/AZ cell lines were maintained in DMEM with 10% FCS, 100 units/ml penicillin, and 100 μg/ml streptomycin. Additionally the medium of the MCF7/AZ cell line was supplemented with 500ng/ml bovine insulin. All cells were grown in a humidified atmosphere of 5%CO2 at 37oC. The induction of ZEB2 in the A431-ZEB2 cell line was achieved upon administration of doxycycline (2 μg/ml, Sigma) for 24, 48 and 96 hrs respectively. The doxycycline was refreshed every 2 days.

Isolation and culture of primary keratinocytes.The isolation of primary keratinocytes was performed as previously described (Caldelari et al., 2000). The cells were seeded at a density of 120.000 cells/cm2 in Defined Keratinocyte-SFM medium (GIBCO, cat. no. 0744-019) supplemented with KGM Single quotes supplements and growth factors (Clonetics, cat. no. CC-4131). Short term culture of primary keratinocytes was performed at 37oC and 5%CO2

Nile Red Staining.OCT-embedded 7um frozen sections of neonatal back skin were stained with 0.15mg Nile Red stain in 75% glycerol. After 2 min the slides were covered with a coverslip, sealed and photographed.

Supplementary tables

Table S1. Immunohistochemical analysis for ZEB2 on human skin samples from various skin diseases.

Eczema / Lichen planus / Lupus / Psoriasis / Pemphigus vulgaris / Normal skin
Negative / 10 / 11 / 10 / 3 / 4 / 14
Positive / 0 / 0 / 0 / 0 / 4 / 0
Total / 10 / 11 / 10 / 3 / 8 / 14

Table S2. Sequences of primers used for the PCR genotyping analysis of the transgenic mice.

Gene / Forward / Reverse / Product (bp)
ROSA26 +/+ / AATCCCTTCCCCCTCTTCC / TTGCTGCATAAAACCCCAGAT / 250
ROSA26 tg/tg / AAAGTCGCTCTGAGTTGTTAT / GCGAAGAGTTTGTCCTCAACC / 311
Cre-recombinase / AACATGCTTCATCGTCGG / TTCGATCATCAGCTACACC / 419
Recombination / CTCTTCGCGGTCTTTCCAGTG / TCTGGGATTGGCTTGTTTGC / 486

Table S3. Antibodies and dilutions used for immunohistochemistry and western blot analysis.

Immunohistochemistry
Antibody / Company, cat. no. / Dilution
E-cadherin / BD Biosciences, cat. no. 610181 / 1:500
β-catenin / Sigma, cat. no. C2206 / 1:100
Claudin-1 / Invitrogen, cat. no. 51-9000 / 1:100
Occludin / Invitrogen, cat. no. 33-1500 / 1:100
ZO-1 / Invitrogen, cat. no. 61-7300 / 1:100
Claudin-3 / Invitrogen, cat. no. 34-1700 / 1:100
Claudin-4 / Zymed, cat. no. 32-9400 / 1:500
Filaggrin / Covance, cat. no. PRB-417P / 1:100
Ki67 / Dako, cat. no. M7249 / 1:30
Zeb2 (mouse) / in-house mouse monoclonal / 1:100
ZEB2 (human) / Sigma, cat no. HPA003456 / 1:300
Keratin-1 / Covance, cat. no. PRB-165P / 1:1000
Keratin-14 / Covance, cat. no. PRB-155P / 1:100
Desmoplakin 1/2 / Progen, clone DP-2.15/2.17/2.20, cat. no. 65146 / 1:50
Plakophilin-1 / Progen, cat. no GP-PP1 / 1:50
Vimentin / Genetex, cat. no GTX112661 / 1:100
Collagen Type I / Cedarlane, cat. no CL50151AP / 1:100
Fibronectin / Abcam, cat. no 23750 / 1:100
Western Blot
Antibody / Company, cat. no. / Dilution
Claudin-1 / Invitrogen, cat. no. 51-9000 / 1:1000
Occludin / Invitrogen, cat. no 42-2400 / 1:1000
β-tubulin / Sigma, cat. no. TUB2.1/T4026 / 1:1000
FLAG-M2 / Sigma, cat. no. F-3165 / 1:1000

Table S4. Sequences of primers and probes used for qRT-PCR analysis.

Gene / Forward / Reverse
ZEB2 / CGAGCGGCATATGGTGACA / GCCACACTCTGTGCATTTGAA
OCC / TCAAACCGAATCATTATGCACCA / AGATGGCAATGCACATCACAA
HMBS / GGCAATGCGGCTGCAA / GGGTACCCACGCGAATCAC
TBP / CGGCTGTTTAACTTCGCTTC / CACACGCCAAGAAACAGTGA
Zeb2 / CAATTGAAGCCAGGCATGAA / AGCTGCAGTACAGTGGCATCA
Cldn-1 / TGGCTGTCATTGGGGGCATAA / TGGGGGTCAAGGGGTCATAGA
Hmbs / GAAACTCTGCTTCGCTGCATT / TGCCCATCTTTCATCACTGTATG
Tbp / TCTACCGTGAATCTTGGCTGTAAA / TTCTCATGATGACTGCAGCAAA
Gene / Probe
ZEB2 / 5’-FAM-CAGATCAGCACCAAATGCTAACCCAAGG-TAMRA-3’