Mir-21 Is Upregulated by Oncogenic Ras in Vitro and in Vivo and Plays a Role in Tumor Growth

miR-21 is upregulated by oncogenic Ras in vitro and in vivo and plays a role in tumor growth

D. Frezzetti, M. De Menna, P. Zoppoli, C. Guerra, A. Ferraro, A. Bello, P. De Luca, C. Calabrese, A. Fusco, M. Ceccarelli, M. Zollo, M. Barbacid, R. Di Lauro and G. De Vita

Expression vectors

Plasmids expressing the human H-Ras V12 oncogene pCDNA3-Ras V12 and its effector domain mutants, pCDNA3-RasV12/S35, pCDNA3-RasV12/G37 and pCDNA3-RasV12/C40, have been previously described (Missero et al., 2000; Rodriguez-Viciana et al., 1997). To obtain ER-Ras chimeras bearing effector domain mutations, Ras effector domain mutants were amplified by PCR from the vectors pCDNA3 RasV12/S35, pCDNA3 RasV12/G37 and pCDNA3 RasV12/C40 using the primers F (5’ ATGACCGAATACAAGCTTGTTG 3’) and R (5’ TATGGTACCGGATCCTCAGGAGAGCACACAC 3’). PCR products were subcloned in pBS-ER vector (De Vita et al., 2005), excised with BamHI and finally ligated in pCEFL vector (De Vita et al., 2005), iIn order to obtain the expression vectors pCEFL-ER-Ras G37, pCEFL-ER-Ras S35 and pCEFL-ER-Ras C40. The pBabe-puro (pBpuro) vector has been previously described (Morgenstern & Land, 1990).

The miR-21 expression vector pCEFL-21 was obtained by PCR amplification of pre-miR-21 sequence plus the flanking 50 bp on both sides, from rat genomic DNA using the primers 21F (5’ ggatccgccagagacgtttgctttg 3’) and 21R (5’ GCGGCCGCCTGACTGCAAACCA

TG 3’). The PCR product was cloned in pCR II-TOPO (Invitrogen, Carlsbad, CA), excised with BamHI and NotI restriction enzymes then subcloned in pCEFL vector.

Cell culture and transfection

FRTL-5 cells and their derivatives were cultured as previously described (Ambesi-Impiombato et al., 1980).

NIH 3T3 cells and their derivatives, and HEK293 cells derived from NIH 3T3 cells were maintained in Dulbecco’s Modified Eagle’s Medium High Glucose (DMEM) supplemented with 10% foetal bovine serum (EuroClone, Wetherby, UK).

FRTL-5 cells expressing ER-Ras or HRasV12 have already been described (De Vita et al., 2005). NIH 3T3 ER-Ras cells were obtained by transfection of NIH3T3 cells with pCEFL-ER-Ras (De Vita et al., 2005). FRTL-5 clones expressing Ras effector domain mutants were obtained by transfection of FRTL-5 cells with pCEFL-ER-Ras G37, pCEFL-ER-Ras S35 and pCEFL-ER-Ras C40. miR-21 overexpressing FRTL-5 clones were obtained by transfection of FRTL-5 cells with pCEFL-21.

All plasmid transfections were carried out by using FuGene 6 transfection reagent (Roche, Mannheim, Germany) following manufacturer’s instructions.

To obtain stable clones, cells were plated at 20% confluency in 100-mm dishes, transfected after 24 hours and 48h after transfection normal medium was substituted with a medium containing 400 mg/ml G418 or 1 mg/ml puromycin (both from Sigma). After two weeks of continuous selection independent cell clones were picked-up and expanded.

For focus assay 2x105 NIH3T3 cells/100-mm dishes were transfected with 3mg of either pBpuro, pBpuro ER-Ras or pBpuro HRasV12 in duplicate. 24 h after transfection, medium was substituted with DMEM 5% newborn bovine serum (HyClone, Logan UT) and duplicates were treated with tamoxifen, or left untreated. Foci were revealed by crystal violet staining 2 weeks after transfection.

For transient transfections FRTL-5 cells were plated at a density of 2x105 per 60mm dish and transfected after 24h. FRTL-5 cells were transiently co-transfected, in triplicate, with 1mg of miR-21-enh-Luc (Talotta et al., 2009) or the empty pGL3Promoter vector (Promega), together with 0.5 mg of pCDNA3-Ras V12 or the Ras effector mutants (1 mg of pCDNA3-RasV12/S35, or 2mg of pCDNA3-RasV12/C40 and of pCDNA3-RasV12/G37) alone or in combination. The amount of total DNA was held constant by including pCDNA3 expression vector. To evaluate transfection efficiency 0.5mg of phRLuc (Promega) vector were transfected in each condition. The amount of Ras-expressing vectors was selected for equal protein expression in HEK293 cells. 48h after transfection cells were harvested and firefly and renilla luciferase activities were measured using the Luciferase Assay System and the Renilla Luciferase Assay System (both from Promega), respectively. Protein extraction was performed using the Passive Lysis Buffer (Promega) supplemented with Protease Inhibitor Cocktail (Sigma). Luminescence was measured using the Lumat LB 9507 luminometer (Berthold Technologies, Bad Wildbad, Germany). Results are expressed as firefly luciferase values normalized by renilla activity. HEK 293 were plated at a density of 2x105 per 60mm dish and transfected after 24h with either empty pCDNA3 (1mg), or one of the following expression vectors: pCDNA3-Ras V12 (0.5mg), pCDNA3-RasV12/S35 (1mg), pCDNA3-RasV12/C40 (1mg), pCDNA3-RasV12/G37 (1mg).

For miR-21 knockdown, FRTL-5 HRasV12 cells (clone V27) were transfected with anti-miR-21 or scrambled LNA oligonucleotides (Exiqon, Vedbaek, Denmark) by Lipofectamine 2000 (Invitrogen, Carlsbad, CA). 48 h after transfection, cells were collected, counted and resuspended into a mix of PBS and Matrigel (BD Biosciences, San Diego, CA) for xenografts, or in TRIzol Reagent (Invitrogen, Carlsbad, CA) for total RNA extraction.

ER-Ras activation was achieved by addition of 100 nM tamoxifen (Sigma-Aldrich, St. Louis, MO) to the culture medium. Kinase inhibitors (Calbiochem, San Diego, CA) were used as previously described (Missero et al, 2000).

Tissue samples

Neoplastic human thyroid tissues were obtained from the Service d’Anatomo-Pathologie, Centre Hospitalier Lyon Sud, Pierre Benite, France. All tissue samples were collected after surgical resection and immediately frozen in liquid nitrogen. Normal thyroid tissues were obtained from Policlinico Federico II, Naples and collected after tracheostomy. Molecular characterization of oncogene mutations was performed as described (Nikiforov et al., 2009).

Lung tumor tissue specimens and adjacent noncancerous tissues were obtained sequentially from 48 NSCLC patients surgically resected at the “Monaldi Hospital, Naples, Italy” from 2004 to 2007. All tissue samples were collected at the time of surgery, immediately flash frozen in liquid nitrogen, and stored at -80°C until use. The histologies of tumor types and the postoperative stages were determined according to the WHO classification method (Brambilla et al., 2001) and Tumor-Node-Metastasis system (Wittekind et al., 2002), respectively. Demographic data and smoking history were available in all patients (see supplemental Table S3). Overall survival and time of recurrence were available in most cases. All patients were treatment naive when the samples were collected.

Statistical Analyses on Lung Tumors Data

We evaluated all our data with respect to miR-21 overexpression by normalizing to the expression of U6 and using the 2-ΔΔCt method. We used a cutoff value of 2.00, with samples having a 2-ΔΔCt value 2.00 considered positive for overexpression. Thus, using the 2-ΔΔCt approach, we have related miR-21 expression in each lung tumor sample to its corresponding adjacent noncancerous sample. All of the data are presented as means ±standard error. Statistical significance was calculated using the Mann-Whitney test. Potential associations between clinico-pathological variables (tumour stage, tumor size, nodal status, histologic tumor type and smoking (expressed as pack/years)) were analyzed by Pearson’s Chi-Squared. The exact coefficient for sample proportion analysis was calculated to determine all of the significant variables (<0.05 level). Significance levels were adjusted according to the Bonferroni method. All analyses were done with the statistical package SPSS 17 for Windows.

RNA extraction

For quantitative Real Time PCR, RNA was extracted from frozen tissues or xenografts and cultured cells using TRIzol Reagent (Invitrogen, Carlsbad, CA) according to manufacturer’s intructions. In order to facilitate RNA extraction from tissues, samples were first omogenated in TRIzol Reagent through the use of a TissueLyser (Qiagen, Valencia, CA).

For Northern blot analysis, RNA was extracted from cells using TRIzol Reagent as already reported (Hafner et al., 2008).

Quantitative Real Time PCR

Quantitative analysis of miRNA expression was performed by RNA retrotranscription and subsequent TaqMan real-time PCR, using either a 7300 or a 7900 Real-Time PCR System as recommended by the supplier (Applied Biosystems, Foster City; CA). For each retrotranscription reaction were used 10 ng of total RNA extracted from cells or 30 ng of total RNA extracted from tissues. Results were expressed as a cycle threshold (CT) value. Normalized CT values were obtained by subtracting the CT value (averaged across two replicates) of a small noncoding RNA control gene (RNU6B) or a miRNA used as control (let-7a) from the raw CT value of miR-21.

Northern blot

Northern blot analysis of miR-21 was performed with 30 µg total RNA/sample separated on a 15% polyacrylamide/8M urea gel, transferred to a Hybond N membrane (Amersham Biosciences, Piscataway, NJ) and UV-crosslinked. Membranes were hybridized in Denhardt’s solution at 50 ºC with 22nt antisense P32 end-labeled oligonucleotide probes complementary to miR-21 (TCAACATCAGTCTGATAAGCTA) or to control tRNA (ATAACCACTACACTACGGAAAC), then washed twice with 1% SDS, 5x SSC and with 1% SDS, 1x SSC. All blots were imaged with a Molecular Imager FX (Bio-Rad Laboratories, Hercules, CA).

Protein Analysis and Immunoblotting

Whole cell lysates were prepared in the following buffer: 50mM Tris, 150mM NaCl, 0,1% SDS, 1% Triton X-100, 5mM MgCl2, 0,5% deoxicolic acid, 0,5 mM Na2P2O7, 0,5 mM PMSF, 1mM DTT, 50mM NaF, 0,5 mM Na3VO4 with the addition of protease inhibitors cocktail 1X (all reagents are from Sigma-Aldrich, St. Louis, MO). Protein concentration was measured by the BCA protein assay reagent (Pierce, Rockford, IL) according to manufacturer’s instructions.

Detection of Ras-Raf interaction was performed through the use of the Ras Activation Assay Kit (Millipore) according to manufacturer’s instructions.

Western blots were performed as previously described (Missero et al., 2000). Pan-Ras rat monoclonal antibody was purchased from Santa Cruz Biotechnology, b-actin and GAPDH mouse monoclonal antibodies were purchased from Sigma. Phospho-ERK1/2, ERK1/2, phospho-Akt1, and Akt1 rabbit polyclonal antibodies were purchased from Cell Signaling. Immune complexes were detected by enhanced chemiluminescence (ECL) as instructed by manufacturer (Amersham Biosciences, Piscataway, NJ). Chemiluminescence was captured and analyzed with a Chemidoc Xrs supported by the Quantity One 4.6.1 software (Bio-Rad Laboratories, Hercules, CA).

Xenografts analysis

2×106 cells were resuspended in 50 ml of PBS, mixed with 50 ml of Matrigel (BD Biosciences) and injected subcutaneously into each flank of 12 NOD SCID female mice of 5 weeks of age. Each animal received control cells on one flank and anti-miR-21 LNA-transfected cells on the other. Tumor volume (V) was calculated as follows: V=L x l x l x π/6, where L represents the larger and l the smaller tumor diameter respectively (Si et al, 2007). Mice were sacrificed after 7, 14 and 21 days after injection (one mouse at each time) to measure the expression of miR-21 in xenografts. Tumors were excised and flash frozen in TRIzol for total RNA extraction. All remaining mice were sacrificed at 25 days after injection.

Microarray Analysis

Total RNA was extracted from either wild type FRTL-5 cells or FRTL-5 clones over-expressing miR-21. Equal amounts of total RNA from 5 different miR-21 over-expressing clones were pooled. Total RNA was further purified by RNeasy columns (Qiagen, Hilden, Germany). cRNA was generated by using One-Cycle target labeling and purification system (Affymetrix, Santa Clara, CA). Biotinylated cRNA were hybridized overnight at 45°C to the GeneChip® Rat Genome 230 2.0 Arrays, containing over 31,099 probe sets. Chips were washed and scanned onthe Affymetrix Complete GeneChip Instrument System, generating digitized image data (DAT) files. Reactions were carried out in triplicate.

Data Processing and Analysis

DAT files were analyzed with AGCC (Affymetrix, Santa Clara, CA) producing CEL files. Robust multichip average (RMA) normalization (Irizarry et al, 2003) and data analysis were performed using GeneSpring 11.0.2 (Agilent Technologies, Santa Clara, CA).

Differentially expressed genes (DEG) were filtered for fold change ≥ 1.2. Statistical analysis was performed using the Welch t-test, with p ≤ 0.01. We obtained 22 MiRNA predicted targets by PITA (Kertesz et al., 2007) retaining the probe sets with a score smaller then -7 among the 1861 differentially expressed probe sets. In Figure 7A are depicted the distribution and cumulative distribution functions of the 22 MiRNA predicted targets by PITA and the 1839 non-target probe sets. Filtered DEGs were functionally annotated by Gene Ontology (GO) for Biological Process. Enriched GO terms (i.e. terms with a significantly higher than expected number of associated genes) were filtered (p ≤ 1*10-8) by the Hypergeometric test and corrected using False Discovery Rate (FDR) (Benjamini Y,1995). Downregulated genes were functionally characterized using a proprietary software, Ingenuity Pathway Analysis (IPA) from Ingenuity Systems® to identify enriched molecular networks and canonical pathways. Networks of miR-21 downregulated genes (called focus genes) were generated based on their connectivity, and for each network a score was computed based on the likelihood of the focus genes participating to the network by chance. Significantly represented canonical pathways in the list of downregulated genes were similarly determined using IPA. The significance of the association between focus genes and canonical pathways was measured by the Fisher's exact test. The p-values were corrected again for multiple testing using FDR.

MiRNA targets prediction was performed by using PITA (Kertesz et al., 2007) and MIRANDA (John et al., 2004) algorithms.

References

Ambesi-Impiombato FS, Parks LA and Coon HG. (1980). Proc Natl Acad Sci U S A, 77, 3455-9.

Brambilla E, Travis WD, Colby TV, Corrin B and Shimosato Y. (2001). Eur Respir J, 18, 1059-68.

De Vita G, Bauer L, da Costa VM, De Felice M, Baratta MG, De Menna M and Di Lauro R. (2005). Mol Endocrinol, 19, 76-89.

Hafner M, Landgraf P, Ludwig J, Rice A, Ojo T, Lin C, Holoch D, Lim C and Tuschl T. (2008). Methods, 44, 3-12.

John B, Enright AJ, Aravin A, Tuschl T, Sander C and Marks DS. (2004). PLoS Biol, 2, e363.

Kertesz M, Iovino N, Unnerstall U, Gaul U and Segal E. (2007). Nat Genet, 39, 1278-84.

Missero C, Pirro MT and Di Lauro R. (2000). Mol Cell Biol, 20, 2783-93.

Morgenstern JP and Land H. (1990). Nucleic Acids Res, 18, 3587-96.

Nikiforov YE, Steward DL, Robinson-Smith TM, Haugen BR, Klopper JP, Zhu Z, Fagin JA, Falciglia M, Weber K and Nikiforova MN. (2009). J Clin Endocrinol Metab, 94, 2092-8.

Rodriguez-Viciana P, Warne PH, Khwaja A, Marte BM, Pappin D, Das P, Waterfield MD, Ridley A and Downward J. (1997). Cell, 89, 457-67.

Talotta F, Cimmino A, Matarazzo MR, Casalino L, De Vita G, D'Esposito M, Di Lauro R and Verde P. (2009). Oncogene, 28, 73-84.

Wittekind C, Compton CC, Greene FL and Sobin LH. (2002). Cancer, 94, 2511-6.

1