Short Legend for Supplemental Materials and Methods:
Table S1. Gene-specific PCR primers designed for cloning ABI1-like family members (PP2Cs) from Arabidopsis cDNA library, and mapping of 3’ ends of transcripts generated in vivo from pCR703::pUNI recombinants by RACE.
Table S2. Sequences of oligonucleotides synthesized to make full length adaptors for cloning different epitope tags into acceptor vectors pCR701- pCR705.
Figure S1. Bidirectional hierarchical clustering meta-analysis of 28 ABI1-Like genes for biotic/chemical/abiotic stresses, shown as relative ratios to controls. The figure is split into two panels (A and B) for convenience of viewing, where the vertical cladogram continues across the panels. (The down-regulation of AHG1 and ABI2 by cycloheximide is discounted because these genes are not expressed under the conditions of the cycloheximide treatment [Fig. 2A; data not shown].)
Figure S2.Schematic representation of the site-directed mutations introduced into the ProUbi:AP2C1mut construct for control experiments on AP2C1 functional effects in protoplasts.
Figure S3. Validation and extension of ABI1-Like PP2C transient expression results using Cre-lox recombination epitope-tagged acceptor vector constructs.
Figure S4. The secondary structure of pUNI51 sequence containing part of the BGH 3’ termination signal (n.t. 417- 565), showing the 3’-RACE validated cleavage site.
Figure S5. Ethidium bromide-stained agarose gel of selected restriction endonuclease mapping results demonstrating the nature of dimers and trimer recombinants.
Figure S6. Ethidium bromide-stained agarose gel of undigested miniprep DNAs of recombinants to screen for dimers versus trimers.
Supplemental Materials and Methods. Details of the isolation and transformation of maize protoplasts, and the construction and characterization of pCR701 through pCR705 acceptor vectors.
Supplemental Table S1. Gene-specific PCR primers designed for cloning ABI1-like family members (PP2Cs) from Arabidopsis cDNA library, and mapping of 3’ ends of transcripts generated in vivo from pCR703::pUNI recombinants by RACE.
Gene name / Accession # / Primer sequenceABI2 / At5g57050f / ggaattcctcctttaatggacgaag
At5g57050r / ggggtaccccaaaccttctttttcaattc
HAB2 / At1g17550f / cgggatccgcgaggtttggaagctgcatac
At1g17550r / ggaattccgagctcgagcatacactgtttc
AP2C7 / At1g07430f / ggggtaccccggaatatttagtagaggc
At1g07430r / ggaattccagagtgatgaggagattagtgtc
AP2C9 / At5g59220f / ggggtaccccgatcacatggctgagatttg
At5g59220r / ggaattccaacaaacattacgagagagac
AP2C15 / At5g10740f / cgggatccgcgtttgaaatttctgaag
At5g10740r / ggggtaccccgctatttataccttgtcg
AP2C1 / At2g30020f / ggaattcctagaaacgatgtcttgctccg
At2g30020r / cgggatccgcctctcttttctatatgaac
AP2C16 / At2g25620f / cgggatccgcgatgatgtttcaatatggaag
At2g25620r / ggggtaccccttttcagtcgtcaccatcctc
AP2C20 / 3RACE_GSP 699-726 / aaggcggattgaagatttaggaggatac
AP2C20 / 3RACE_GSP nested 962-987 / acccgagacaatgtgcgatggaacta
AP2C7 / 3RACE_GSP 846-868 / ccaagaagcaggaggacgagtga
AP2C7 / 3RACE_GSP nested 1095-1119 / aagacggcgaggagaaacacagact
Supplemental Table S2. Sequences of oligonucleotides synthesized to make full length adaptors for cloning different epitope tags into acceptor vectors pCR701- pCR705. Kozak consensus sequences are shown in bold,loxH sites in italic.
Acceptor vector / Oligo sequence (5’-3’)pCR701
(loxH) / F: cgggatccattacctcatatagcatacat
R: ggaattcataacttcgtataatgtatgct
pCR702
(6His-loxH) / F: cgggatccaaaatggctcatcatcatcaccatcatattacctc
R: ggaattcataacttcgtataatgtatgctatatgaggtaatat
pCR703
(2HA-loxH) / F: cgggatccaaatggcttacccttacgatgtgcctgatta
cgcttatccttatgatgttcc
R: ggaattcataacttcgtataatgtatgctatatg
aggtaatagcataatcaggaacatcat
pCR704
(2FLAG- loxH) / F: cgggatccaaaatggattacaaggatgatgatgataa
gggagattataaggacgatgacg
R: ggaattcataacttcgtataatgtatgctatatgagg
taattcctttatcgtcatcgtc
pCR705
(2cMyc- loxH) / F: cgggatccaaaatggagcaaaagttgatcagcg
aggaggatttggagcagaaacttatcagc
R: ggaattcataacttcgtataatgtatgctatatatgag
gtaatcaaatcctcctcgctgataagt
Supplemental Materials,Methods and Results
Isolation and transformation of maize protoplasts
The middle part of the second leaves (about 6 cm in length) was cut into strips with a razor blade and digested with gentle shaking in 1% (w/v) cellulase RS, 0.1% (w/v) macerozyme R10 (Karlan Biochemicals, 0.6 M mannitol, 10 mM MES (pH 5.7), 1 mM CaCl2, 1 mM MgCl2, 10 mM β-mercaptoethanol, and 0.1% BSA (w/v) for 1.5 h at room temperature. The protoplasts were sieved through 70 µm nylon mesh (Carolina Biologicals. and centrifuged in a conical polypropylene tube at 700 rpm for 5 min. The pellet was washed twice and resuspended in wash/incubation solution (WI: 0.6 M mannitol, 4mM MES, pH 5.7) at a density of 2 x 106/mL on ice. Cell viability was measured by staining the protoplasts with 0.01% (w/v) fluorescein diacetate and visualizing on an Olympus BX41 epifluorescence microscope and hemacytometer. For electroporation, 2 x 105 protoplasts in 300 µL were mixed with DNA and transferred to pre-chilled 0.4 mm cuvettes or microplates (Bio-Rad. . They were kept on ice for 10 min and were electroporated (350 V, 150 µF 25Ω and one pulse) with a BioRad Gene Pulser. Typically 50 µg of DNA for reporter constructs (40 µg of ProEm:GUS and 10 µg ProUbi:LUC) plus 30 µg of DNA for effector constructs were used for transformations. After electroporation, protoplasts were transferred to 12-well microplates coated with a 5% solution of fetal calf serum and were incubated with or without 100 µM ABA in WI solution. After 16 h incubation in the dark at room temperature, transformed protoplasts were processed for quantifying β-glucuronidase (GUS) and luciferase (LUC) reporter enzyme activities as previously described (Finkelstein et al., 2005).
Construction of pCR701 through pCR705 acceptor vectors
A vector backbone (pDH349s; Gampala et al., 2002) containing the maize Ubi promoter and a 3’ 35S polyadenylation signal was obtained by digesting pDH349 (ProUbi:VP1::Myc) with EcoRI and BamHI to release the VP1::cMyc fragment. The vector backbone was ligated to various loxH- containing adaptor fragments. The FLAG epitope is 2x DYKDDDDKG; the cMYC epitope is 2x EQKLISEEDL; and the hemaglutinin (HA) epitope is 2x YPYDVPDYA. Adaptor fragments with loxH alone (CR701) or loxH-epitope tag adaptor fragments containing His6-, 2xHA-, 2xFLAG- and 2xcMyc- codons (CR-702, -703, -704 and -705, respectively; Supplemental Table S2) were annealed and extended by mutually primed synthesis. The BamHI/EcoRI restricted products were separated on a polyacrylamide gel, extracted, and the sticky ends ligated to pDH349s vector to obtain the acceptor constructs pCR701- pCR705. All the pCR70x clones were validated by sequencing. In addition, the 4.8 kbp pDH349s vector backbone was used for conventional cloning of several Arabidopsis cDNAs amplified by PCR from a cDNA library (Minet et al., 1992) with high-fidelity Pfu enzyme using gene-specific primers (Supplemental Table S2).
We addressed some technical aspects of known regulatory elements for efficient transcription and translation in eukaryotes in the design of the pCR70x acceptor vectors. Translation in eukaryotes proceeds by binding of a ribosome small subunit to the 5’-methylcapped mRNA and scanning by the ribosome for the initiation AUG codon. Important determinants of the initiation codon are the bases in positions -3 and +1, which can influence the efficiency of translation by 10-fold (Kozak, 1983). The adapter fragments for cloning the pCR70x acceptor vectors were designed to contain a Kozak consensus sequence (CCAAAAUGG; initiation codon underlined) in-frame with the epitope tag sequences. Because hairpins in the 5’ UTR may impede migration of ribosomes and/or transcriptional machinery that could reduce expression levels in pCR701, we disrupted the inverted repeat in the loxP site (ΔG = -14.5 kcal/mole) by synthesizing the adaptor fragments with a variant loxH site. LoxH differs from loxP by three nucleotides which disrupts potential secondary structure of the palindrome (ΔG = -1.2 kcal/mole) yet it can undergo efficient recombination with loxPin vitro(Abremski et al. 1983). Because the loxH site undergoes recombination in vitro at 25% efficiency relative to loxP (Liu et al. 1998) and results in ~5% product yields (efficient enough for easy selection), it was deemed prudent to synthesize the loxH variant instead of loxP in pCR702- pCR705 constructs to minimize secondary structures in mRNAs that might affect translation.
Characterization of the in vitro Cre-lox recombination reaction
The Cre-recombination reaction produced recombinant trimers in addition to the desired dimers, which warranted further examination to characterize the underlying mechanism. We performed restriction mapping of dimers and trimers and observed the trimers comprised typically two donors and one acceptor vector (Fig. S5). Occasionally a trimer was found with two acceptors. We observed a positive correlation between the number of isoforms in a particular mini plasmid preparation and the abundance of trimers derived from the isoform-associated plasmid prep (Fig. S6; data not shown). Characterization of miniprep recombinants by a simple high-throughput sizing gel electrophoresis of mini-prep recombinant DNAs gave satisfactory results in that dimers could be identified from only a few clones (Fig. S6). Supplemental Figs. S5 and S6 show selected results of mapping and sizing dimers versus trimers for FLAG::AP2C2, HA::AP2C7, HA::AP2C2, FLAG::AP2C12, AP2C16, and AP2C18. It is suggested that if whole (normalized) cDNA libraries of pUNI clones are to be recombined for high-throughput studies, that input plasmids be purified by CsCl density gradient ultracentrifugation banding so that the recombination reaction is carried out with supercoiled monomers that will produce predominantly dimers.
3’-RACE mapping to test the function of an extant Bovine Growth Hormone transcription termination signal in the pUNI vector
Computational analyses of plant UTRs have led to the discovery of additional sequence determinants and secondary structures for polyadenylation beyond the eukaryotic canonical Near Upstream Element (NUE) located at -13 to -30 n.t. from the polyA tract (Loke et al. 2005). Because the pUNI51 vector used in constructing full length Arabidopsis cDNAs had no documented eukaryotic polyadenylation signal sequence, we searched downstream of loxP in pUNI51 for candidate polyadenylation signals and were surprised to find the unannotated sequence of the bovine growth hormone (BGH) genomic polyadenylation signal (Goodwin and Rottman 1992) at n.t. position 376- 605. Because pUNI51 is derived from pUNI50 (Liu et al. 1998), which has a documented mammalian polyA sequence, it appears this fact has been overlooked in the annotation (GenBank accession AY260846). This situation may have deterred greater utilization of the UPS Arabidopsis cDNAs to date by the plant research community.
We analyzed the potential utility of the existing mammalian polyadenylation sequence in pUNI51 for function in plants by computational methods, taking into account the spacing, nucleotide composition, and secondary structures associated with the NUE (AAUAAA) 19 bp upstream from its known cleavage site (CS) in animals (TCGCA//TTG where // denotes CS). We demonstrated that the BGH polyadenylation sequence in pUNI51 could serve as a robust transcription termination signal in plants based on the following evidence: 1) The NUE (AAUAAA) is the top-ranked hexamer found in annotated Arabidopsis genes. 2) The sequence of the CS (UCGCA//UUG) is a very good match with the top-ranked Arabidopsis CS consensus (UUUPyA//UUU), with requisite nucleotides (PyA) at positions -2 and -1 and U-rich flanking nucleotides. 3) The spacing between the NUE and the predicted cleavage site (19 n.t.) is optimal for Arabidopsis (Loke et al. 2005). 4) The secondary structure of the BGH 3’ termination sequence in pUNI51 shows a prominent bulge at the NUE and a cluster of secondary structure at the predicted CS, both of which have been functionally validated as necessary and sufficient for activity in plants (Loke et al. 2005 and references therein)(Supplemental Fig S4). 5) We validated the BGH-directed cleavage site by 3’ rapid amplification of cDNA ends (3’RACE) in RNAs extracted from two effector transient gene expression experiments with different pCR703:pUNI:cDNA recombinants (Supplemental Fig. S4).
Protoplasts were transformed with 30 μg effector (HA::AP2C20 or HA::AP2C7) and 5 μg ProUbi:LUC and were cultured overnight following the standard protocol . Eight electorporations were pooled to give ~600,000 protoplasts in 5 mL WI solution and an aliquot was analyzed for LUC activity. The remaining protoplasts were pelleted and total RNA extracted using RNAqueous-Micro isolation kit (Applied Biosystems/Ambion, including the DNAse treatment step. The resulting RNA solution contained 6 μg total RNA, half of which was treated with RNaseA at 37º C for 20 min as a negative control. The RNA samples were processed using GeneRacer Kit (Invitrogen) in parallel with 3 μg total RNA.
For 3’RACE, first-round PCR and nested PCR were performed and bands of the predicted sizes were obtained. The nested PCR products were eluted from an agarose gel using QIAEX II gel extraction kit (Qiagen, www1.qiagen.com). Fragments were cloned with TOPO TA Cloning Kit (Invitrogen). Fifteen colonies of each experimental group were confirmed by restriction digestion mapping. Four clones were subsequently sequenced to identify the transcription termination site, the result of which is shown in Supplemental Fig. S4. Primers for 3’RACE are listed in Supplemental Table S1.
References
Goodwin EC, Rottman FM (1992) The 3´-flanking sequence of the bovine growth hormone gene contains novel elements required for efficient and accurate polyadenylation. J Biol Chem 267: 16330- 16334
Kozak M (1983) Comparison of initiation of protein synthesis in prokaryotes, eukaryotes, and organelles. Microbiol Rev 47: 1- 45
Loke JC, Stahlberg EA, Strenski DG, Haas BJ, Wood PC, Li QQ (2005) Compilation of mRNA polyadenylation signals in Arabidopsis revealed a new signal element and potential secondary structures. Plant Physiol 138: 1457- 1468
1