Practice Polymerase Chain Reaction Lab

Practice Polymerase Chain Reaction Lab

Amplifying the Green Fluorescent Protein Gene

Polymerase Chain Reaction (PCR) is a technique that requires great care to complete. But it is so powerful because you can take very small amounts of DNA and make tons of it. You can even do modified PCR reactions and add mutations or extra DNA to change a protein!

Today you will be amplifying a gene found in jellyfish called Green Fluorescent Protein (GFP). Point in fact, for this experiment you could use literally any small gene because the point of what you are trying to do today is to learn the techniques needed to do PCR. You also need is single stranded primers for your target gene. Scientists regularly design those using basic base pairing rules. With these two things a a few reagents you can do PCR for GFP and amplify the DNA!

How does that work?

If you had a target gene with a known DNA sequence (for example in bold below):

5’-ATAGCCTAGAGCCCGGGTATACCCTATAGTATAGCGGATATCTGAACCTGGATAGGGC-3’

3’-TATCGGATCTCGGGCCCATATGGGATATCATATCTGCCTATAGACTTGGACCTATCCCG-5’

And you could heat it up to say 94oC to cause the DNA to break the hydrogen bonding (AKA melt), for example:

5’-ATAGCCTAGAGCCCGGGTATACCCTATAGTATAGCGGATATCTGAACCTGGATAGGGC-3’

3’-TATCGGATCTCGGGCCCATATGGGATATCATATCTGCCTATAGACTTGGACCTATCCCG-5’

You could design short single stranded pieces of DNA called primers that will anneal (hydrogen bond to) the DNA when you cool it down. Note the annealing is done in an antiparallel fashion, for example:

5’-ATAGCCTAGAGCCCGGGTATACCCTATAGTATAGCGGATATCTGAACCTGGATAGGGC-3’

3’-CCTATAGACTTGG-5’ (upper primer)

5’- CTAGAGCCCGGGTATA-3’ (lower primer)

3’-TATCGGATCTCGGGCCCATATGGGATATCATATCTGCCTATAGACTTGGACCTATCCCG-5’

If you added a DNA polymerase and deoxynucleotides (known as dNTPs which are a mix of ATP, GTP, CTP and TTP), the DNA polymerase will grab on to the 3’ end of the primers and copy the template in bold in a complementary fashion, for example:

5’-ATAGCCTAGAGCCCGGGTATACCCTATAGTATAGCGGATATCTGAACCTGGATAGGGC-3’

3’-TATCGGATCT CGGGCCCATATGGGATATC ATATC GCCTATAGACTTGG-5’ (upper primer)

5’- CTAGAGCCCGGGTATACCCTATAGTATAGACGGATATCTGAACCAGGATAGGGC-3’

3’-TATCGGATCTCGGGCCCATATGGGATATCATATCTGCCTATAGACTTGGACCTATCCCG-5’

Question:

One of the way to measure the length of nucleic acids is in bases or if it is double stranded like this one is in “base pairs” (bp). How long is the template (in bold) and how long is the product made by the DNA polymerase here?

Why is PCR So Persnickety?

Contaminating DNA in any reagent or on pipetors, tips or tubes can lead to false positives. Normally, for PCR reactions the negative control does not have DNA template in it and thus no bands should be seen. A false positive means having bands in the negative control.

Moreover, the conditions needed for the enzyme (Taq DNA Polymerase) are very precise. Poorly made or maintained reagent can lead to a false negative (e.g. a positive control which does not produce a band). In addition, poorly performed calculations or reagent preparation can also lead to false negatives, etc.

So GREAT care must be taken in handling the PCR reagents!

(n.b. remember negative controls protect against false positives, and positive controls protect against false negatives)

Today, we will perform PCR and you will learn about the substrates, enzyme and reagents needed to perform this technique. You will use reagents that total $600 to purchase and equipment that costs more than $20,000.

It is imperative that you follow all directions as given to you by your professor.

You will be expected to write this experiment into your notebook and it will be graded as part of your lab notebook grade. This includes the calculations you will do to predict how to make 50X Tris/Acetic Acid/EDTA (50X TAE) buffer.You do not need to make this reagent just work through how you would make it.You do not need to include the recipe for the blue juice sample buffer (only mention what it is made of generally and realize that the concentrations of the chemicals used for that are also precise).

You will be working in at least pairs for this experiment.

Activity #1:

The first part of the procedure requires that you calculate how to make the 50X TAE running buffer stock that you will use at the end of the experiment to run your gel electrophoresis. You already know that you must combine 121 g Tris base, 57.1 ml of glacial acetic acid and 100 ml of 0.5M EDTA, adjust it to pH 8.0 and bring the total volume to 1L with ultra-pure molecular grade water.

The Tris base is a powder which you weigh-out. The acetic acid is a solution you measure with a pipetor.
You must determine how to make a 500 ml stock solution of 0.5M EDTA, pH 8.0 if the molecular weight of the EDTA is 372.24 g/mole.
Remember that the solution will have to be adjusted to pH 8.0 by using a pH meter and either acid or base, before you bring the solution to 1L with ultra-pure water.
Your professor will explain this process in more detail. Take good notes! You will be expected to do calculations like this one for an exam.
Calculations for this reagent should be recorded in your lab notebook.

Space For Calculations:

Activity 2- The PCR Procedure:

Next you must determine what reagents must go into the PCR tubes, and how much.

Your professor will help you plan the following reaction to amplifythe GFP genewith the following characteristics:
0.1g of DNA template
50 pmoles of both upper and lower primers to detect GFP
200M deoxynucleotide triphosphates (dNTPs are a mix of ATP, GTP. CTP and TTP)
0.5-1 U Taq DNA polymerase
1X Taq polymerase buffer
final total reaction volume of20 l (often written VT= 20 l)

You will also need sterile ultrapure water to add to your reaction to bring it to 20 l and for all your dilutions.
After this you can begin to assemble your PCR. Planning and calculations must be worked-out below and recorded in your lab notebook.

The PCR reaction you put together should be recorded in a manner that someone could reproduce what you did. So if you only cite a volume and not a concentration, no one could reproduce what you do.

A volume alone is not an amount!!!

Don’t forget your negative control! The negative control will be a PCR reaction without any DNA template. You will essentially be running PCR with a sample that we know has GFP, so it is effectively a positive control. You will thus have only 2 tubes in this experiment to help you get a feel for doing PCR.

Calculations and Planning Notes:

Activity 3- Assembling the PCR reaction:

It is essential that you wear clean gloves for the entire procedure! You must keep them clean!
Think about how you would handle ebola virus and use those kinds of precautions.
The Taq enzyme should be handled only by your instructor!!!!

When using the tubes and tubes of reagents-

It is essential that you do not touch the inside of the tubes or the cap area on the PCR tube!
For each reaction you build, it is essential that you label the PCR tube near the rim of the tube!
Any dilutions you do, you need to label so that a scientist walking off the street would know what it was, the concentration, the date you did the dilution and the source of the reagent.

Your professor will set-up a PCR reaction along side of the class, to be essentially a positive control

STEP 1-Using sterile forceps and gloves, obtain two PCR tubes from the box. Just underneath the lip of the tube, number the tubes and initial them with a very fine sharpie pen. Place the tubes into the provided rack.

B. Adding reagents to the tube-

It is essential that the reagents be kept contaminant free!
Never use a tip more than once for any reagent! So have a beaker to shoot your used tips handy at your bench. We have tri-pour beakers for that purpose.
It is essential that the reagents are added in the right order!
You must wear gloves.
All enzymes must be kept at -20oC at all times!!!!!Your instructor will handle the enzyme for you.
Reagents like dNTPs and buffer need to be thawed on ice and stored on ice during the procedure at all times!
It is essential that you do not touch the inside of the tubes or the cap area on tubes of reagents!

STEP 2- Do all the dilutions of primers and dNTPs to set-up your reaction as you planned earlier.

STEP 3-Using the recipe you developed add the reagents in the following order:

1-Molecular grade water

2-DNA template

3-10X Taq buffer

4-Upper primer

5-Lower primer

6-dNTPs

With your professor’s supervision add:

7-Taq

STEP 4- Your labeled PCR tubes will be placed into a thermocycler which will cycle 30 times between 94oC, 55 oC and 72oC. You professor will explain why those three temperatures are needed and how long each cycle will be performed.And you will find a fully narrated animation on Angel that explains the process visually as well. But essentially they are:

1)melting temp (94oC) where the two strands of DNA will separate

2)annealing temp (55 oC) where the single stranded DNA primers will hydrogen bond to the melted DNA template. The annealing temp varies depending on the sequence of primers used.

3)extension temp (72oC) where the Taq DNA polymerase binds to the 3’-end of the primers and uses the template to add a complementary nucleotide in each place until the template is completely copied.

Question:

Why does the annealing temperature vary with different primer sequences at all?

The thermocycler will be set for the following steps,which should be recorded in your notebook:

Step 1-94 oC/2 min (melting-hot enough to have the 2 strands of DNA detach from each other)

Step 2-94 oC/ 30 s (melt)

55 oC/ 1 min (anneal)

72 oC/ 1 min (extend)

Step 3-72oC/ 5min (long final extension to ensure all primers are extended fully)

Step 4- 4 oC/ hold (to keep the samples cold until storage in a -20oC freezer)

C. Electrophoresis of the PCR samples-This may have to be done in the next lab period

An 8 lane 1.2% agarose gel will be poured and ready for you for the lab.

However, you are responsible for knowing how to pour such a gel which you will do in subsequent labs.
Your gel contains 1.2 g agarose/100ml 1X TAE.
It also contains sybrsafe, a DNA dye that lodges inside the DNA double helix, between the nitrogenous bases (a process called intercalation). The dye intercalates into the DNA as the gel is electrophoresed through the gel (i.e. after an electrical current is applied to the gel containing the DNA samples). The amount of sybrsafe to add to your gel will be stated on the label of the reagent. When the gel is illuminated by uv light, the sybrsafe will make the DNA glow green, and you will see it. See Figure 1.

The samples you will run will be 1) DNA ladder (DNA fragments of known sizes used to estimate the size of your products from PCR), 2) your negative control (water only/no DNA template added to the PCR reaction) and 3) your PCR reaction. Several gels will be run for the lab, and each pair will load their PCR reaction and negative control. Consult with your professor to determine how much ladder you will need to load on the gel. Each ladder is different so the amount you load is different.

Your professor will set-up a PCR reaction along side of the class, to be essentially a positive control

Your professor will prepare and load the ladder on to the gel.

Your professor will have one extra gel for you to practice loading samples

Figure 1- DNA Gel- Lane 1 is the DNA ladder as indicated

Lanes 2-7 are samples that have multiple bands. PCR

should only yield on band in your experiments.

( detail&id=B4BB98B4C1E969739F66832336455BBB2E43B76C&first=1)

STEP 1-Prepare your gel. The gel will be placed in the electrophoresis apparatus, and flooded with running buffer (1X TAE buffer diluted from the 50X TAE stock with ultra-pure water, so a 1:50 dilution). The wells in the gel should be next to the black (negative electrode from which the electrons will be introduced to the buffer using an electrical current). DNA is a negatively charged molecule so it will move from the black electrode to the red (positive) electrode. See Figure 2.

Figure 2- An Explanation of Gel Electrophoresis

()

STEP 2- Prepare your samples for loading by carefully mixing 2 l of 5X blue juice (a fold concentrated solution of glycerol, Tris-EDTA buffer and blue dyes bromophenol blue and xylene cyanol) and 5 l of each PCR reaction on a piece of parafilm. The parafilm will not absorb the fluids, so mixing is very easy to do, so long as you DON’T HAVE THE PAPER SIDE UP!!! Mix carefully with your micropipetors, and don’t create air bubbles!!!! If you do, the sample will be pulled-out of the well when you load your gel.

STEP 3- Load your samples.

Your professor will show you how to load a gel using the practice gel

First practice loading sample buffer on the practice gel.When you are comfortable with the technique, load your samples. Each sample should be loaded through the running buffer into the wells in the gel according to the gel key below. Take your time and don’t allow the samples to bleed into the next lane.

Gel Diagram:

Lane #SamplePredicted size of fragments

1DNA ladder(loaded by your professor)will show later

2neg. control-water only/no DNA template (gp #1)no band

3GFP PCR product (gp#1)700bp

4neg. control-water only/no DNA template (gp #2)no band

5GFP PCR product (gp#2)700 bp

6neg. control-water only/no DNA template (gp #3)no band

7GFP PCR product (gp#3)700 bp

8pos. control-PCR reaction set-up by your professor700 bp

3) The samples will be electrophoresed on the gel at 75V until the first blue dye reaches ¾ the way down the gel. The gel will be stopped and visualized using UV light in a gel documentation system. The sybrsafe dye is fluorescent and will absorb UV and emit light when it is exposed to UV light. This will be seen visually on the gels as a white band (see Figure 1). A picture will be taken of the gel and each person should have a copy to put into your lab notebooks.

4) Record all of your experiment and if your experiment did not work, include why you think that happened. Provide solutions that might improve a bad result, should that be found. Remember that poor pipeting skills, inactive enzymes because of poor handling, poorly made buffers or inaccurate calculations, etc may explain a false negative.

Questions:

Explain why is DNA a negatively charged molecule?

What are other ways that might cause a false negative or false positive?