Functional and Integrative Genomics

Supplementary material

A novel alkyl hydroperoxidase (AhpD) of Anabaena PCC7120, heterologously confers abiotic stress tolerance in Escherichia coli

Alok Kumar Shrivastava1, Shilpi Singh2, Prashant Kumar Singh1, Sarita Pandey1 and LalChand Rai1*

1. Molecular Biology Section, Laboratory of Algal Biology, Centre of Advanced Study in

Botany, Banaras Hindu University, Varanasi-221005, India

2. Shobhit University, Department of Bioinformatics, Merrut, India

Corresponding author:

Professor L. C. Rai,

Molecular Biology Section,

Banaras Hindu University, Varanasi-221005, India

Tel. No: +91- 542-6701110

Fax No.: +91- 542-2368174/2366402

Email: ;

Supplementary material

Table S1.Primer sequence of genes used for RT PCR and qRTPCR.

Gene / Primer sequence for QRT
all5371 / Forward AGGTGATGGCTAGTCCTGGT
Reverse TTCATTCCCTTCCCACGAGC

Table S2.Protein name, PDB code, percent similarity, Z-score,sequence length and respective organism showing structural similarity with All5371.

PDB
code / Model / Length / %-tage
identity / a.a.
overlap / z-score / Protein name
2ouw(A) / X-ray1.95Å / 135 / 58.6% / 116 / 639.2 / Crystal structure of alkylhydroperoxidaseAhpDcore (yp_4253 RhodospirillumrubrumATCC11170 at 1.95 a resolution
2prr(A) / X-ray2.15Å / 190 / 27.4% / 84 / 171.2 / Crystal structure of alkylhydroperoxidaseAhpD core: uncharaperoxidase-related protein (yp_296737.1) from Ralstoniaeut JMP134 at 2.15 a resolution
2o4d(A) / X-ray1.85Å / 144 / 33.8% / 65 / 170.4 / Crystal structure of a hypothetical protein from Pseudomonasaeruginosa
2oyo(A) / X-ray1.51Å / 186 / 30.0% / 70 / 162.0 / Crystal structure of uncharacterized peroxidase-related prot (yp_604910.1) from DeinococcusgeothermalisDSM 11300 at 1. Resolution
1gu9(A) / X-ray1.90Å / 172 / 33.8% / 65 / 153.2 / Crystal structure of Mycobacterium tuberculosis alkyl peroxidaseAhpD
2gmy(A) / X-ray1.60Å / 147 / 33.9% / 59 / 134.2 / Crystal structure of a protein of unknown function atu0492 f Agrobacteriumtumefaciens, putative antioxidant defence protein

Fig. S1A. Blast search of Anabaena sp. PCC7120 genome for ahpD like gene

Fig. S1B. RTPCR of all5371 gene under abiotic stresses and 16S rDNA as an internal control, Lane (M) DNA ladder, (N) negative control, (L1) control, (L2) carbofuron, (L3) NaCl, (L4) copper, (L5) heat (L6) UVB, (L7) cadmium.

Fig. S1C. Relative intensity graph of transcript analysis.All values are mean ± SD. Alphabetical letters are the result of one way analysis of variance (ANOVA) and denote the significant differences within the dataset

Fig. S1D.Quantification of transcript level of all5371 of Anabaena PCC7120 under UV-B, NaCl, Cu, Cd, heat and carbofuron by qRT-PCR.

Fig. S2.Multiple sequence alignment of All5371 homologs from NCBI database

Fig. S3. Structure-based multiple sequence alignment of All5371 Anabaena PCC7120 homologs. The corresponding PDB code and organisms name are listed below: pdb|2ouw(A)/ Rhodospirillumrubrum ATCC 11170;|pdb|2prr(A)| Ralstoniaeut JMP134;|pdb|2o4d(A)| Pseudomonasaeruginosa; |pdb|2oyo(A)|DeinococcusgeothermalisDSM 11300; |pdb|1gu9(A)| Mycobacteriumtuberculosis; |pdb|2gmy(A)| Agrobacteriumtumefacien.

Fig.S4.Phylogenetic tree of All5371 constructed using UPGMA and MEGA 5.03 software after multiple sequence alignment of 19 homologs using ClustalW program.

Fig. S5. Secondary structure of All5371

.

(A) (B)

(C)

Fig.S6.Qsite finder analysis of All5371 representing (A) 10 possible active sites, (B) amino acids composition and (C) Interaction of tBOOHwith different amino acid residue of 3D protein.

Fig.S7.Cloning, expression and purification of all5371 (A) PCR amplification of Anabaena sp. PCC7120 ORF all5371.Lanes M PCR marker, L PCR product of all5371 (393 bp). (B) Agarose gel showing BamHI and EcoRI double-digested recombinant clones containing 393-bp fragment and 4.9-kb pGEX-5X-2 vector. Lanes M DNA ladder (1 kb), L1 double-digested pGEX, L2 double digestion of pGEX-5X-2-all5371 with BamHI and EcoRI showing release of 393-bp insert, and L3 PCR product of all5371 (393 bp). (C) Colony PCR of transformed cell from marker plate Lanes M PCR marker, L1-L2 colony without gene of interest, L3-L6 colony with gene of interest. (D) qRT-PCR of all5371 gene without IPTG and with IPTG. (E) SDS-PAGE (12 %) showing expression of recombinant protein in E. coli. Lanes M protein marker, L1 whole cell lysate of E. coli BL21cells containing the empty vector pGEX-5X-2 without IPTG induction, L2 empty vector pGEX-5X-2 after 4-h induction with 0.2 mM IPTG, L3 plasmid pGEX-5X-2-all5371 without IPTG, L4 plasmid pGEX-5X-2- all5371 after 4-h induction with 0.2 mM IPTG. The number on the right side is the apparent molecular weight of the recombinant All5371 protein (40.55 kDa). (F) Immunoblot detection of GST+All5371 protein in transformed E. coli BL21 with empty and recombinant vectors. (G) SDS-PAGE profile, (M) protein marker, (L1) whole cell lysate of E. coli cells containing pGEX-5X-2-all5371 after IPTG induction, (L2) purified recombinant protein GST+All5371.