Both Data and Materials and Methods

Supplementary Material

(Both Data and Materials and Methods)

Supplementary Figure 1 : Panel A Expression of N-terminal 6xHis tagged nat IL-2. Molecular weight markers are shown in lane 5. Lanes 1,3,6 and 8 show total cell lysates for uninduced cultures showing leaky expression, of four different clones. Lanes 2, 4, 7 and 9, show the corresponding respective total lysates for induced cultures. Panel B Ni-NTA purified, on column refolded N-terminal 6xHis tagged nat IL-2. Lane 6 contains molecular weight markers. Panel C MALDI-TOF peptide mass fingerprint (PMF) profile of fragments of N-terminal 6xHis tagged nat IL-2 derived through trypsin digestion. The expected tryptic masses which matched, with 1 Da tolerance, have been labelled. The sequence coverage of these fragments is shown in red, in the inset.

Supplementary Figure 2 : Dynamic (quasi-elastic) light scattering data for on-column (Ni-NTA) refolded IL-2 of native amino acid sequence (nIL2). The protein was refolded on column through gradual reduction of denaturant as described in the main Materials and Methods section, with 500 mM arginine and 1 M imidazole used in the elution buffer to aid solubility. The nIL2 population can be seen to consist primarily of a somewhat polydisperse set of sub-populations with hydrodynamic radii varying between ~4 and ~30 nm, with most of the population consisting of particles of hydrodynamic radius >8 nm. Monomeric nIL2 (~17 kDa) would be expected to display a radius < 2 nm, like lysozyme (~14 kDa).

Supplementary Figure 3 : Gel filtration elution from a Superdex-75 column of a sample of on-column (Ni-NTA) refolded IL-2 of native amino acid sequence (nIL2). Arginine (500 mM) was maintained in the column running buffer, but imidazole (1M) was not maintained in the column running buffer, i.e., it was allowed to fractionate away from the protein. The nIL2 population can be seen to consist primarily of soluble aggregates eluting in the void volume of the column (~8 ml), with the arginine preventing any binding to column media (seen otherwise).

Supplementary Figure 4 : Dynamic (quasi-elastic) light scattering data for a sample [on-column (Ni-NTA) refolded IL-2 of native amino acid sequence (nIL2)] collected after passing through a gel filtration column. The protein was originally refolded on column through gradual reduction of denaturant as described in the main Materials and Methods section, with 500 mM arginine and 1 M imidazoleused in the elution buffer to aid solubility. Thereafter, during gel filtration, no arginine was used in the column running buffer, allowing the arginine to separate away from the protein, although 1 M imidazole was used in the column running buffer and maintained in the vicinity of the protein at all times. The collected sample - which was subjected to light scattering – was from the bed volume of the column, indicating that it was binding to the column during gel filtration. This nIL2 population can be seen to consist primarily of a hydrodynamic radius of ~100 nm. Together, the data in this figure and in Supplementary Figures 2 and 3 suggest that when imidazole is used without arginine the protein forms much bigger soluble aggregates (which also interact with the material of the gel filtration column), whereas when arginine is used the soluble aggregates are smaller and the protein also does not bind to the column (eluting in the void volume).

Supplementary Materials and Methods

Cloning and expression of IL2 and its variants

Native IL2 and variants designed to sterically block nose-tail docking. The c-DNA of native IL2 was procured from SAF Labs and modified to produce (i) an N-terminally 6xHis affinity-tagged IL2 clone with a TEV protease site, (ii) an N-terminally His-tagged IL2 with a stuffer fragment at the C-terminus, (iii) aC-terminally 6xHis affinity-tagged IL2 clone, and (iv) aC-terminally 6xHis affinity-tagged IL2 clone with a stuffer fragment at the N-terminus.

We amplified the cDNA for IL2 using the forward primer 5’-TATACTACCGGATCCGAAGGGGGCTACGCTCAAGGTGCACCTACTTCAAGTTCTACAAAGAAAACACAGC-3’ and the reverse primer 5’-AATTAT ACTAGTAAGCTTCTAAGTCAGTGTTGAGATGATGC-3’, using deep vent (NEB) at 45°C. The amplicon was digested with the restriction enzymes, BamHI and Hind III, for subcloning into pQE30 vector containing an ampicillin resistant marker. The digested product was ligated with BamHI and Hind III digested pQE30. Besides a selection marker (ampicillin resistance), the vector provides an inducible promoter, the transcription start site, the translation start site, and an N-terminal affinity tag (N-MRGSHHHHHGS-C). The bases used in the vector to encode the last two residues of the tag, i.e., G and S, together constitute the Bam HI site, allowing insertion of the synthesized genes. The vector also provides a stop codon after the Hind III site but we preferred to use a stop codon before the Hind III site, immediately after the C-terminal threonine (last amino acid). Transformation of the ligated vectors was done into competent E.coli XL-1 Blue cells which contain tetracyclin resistant marker integrated in its genome. Selection of clones was done on LB plates containing tetracycline and amplicillin. Protein expression was checked in MI5pRep4 cells which have kanamycin resistance [supplementary figure (panelA)].

Cloning of an N-terminally His-tagged IL2 with a stuffer fragment at the C-terminus was done in a manner similar to that used for the clone carrying only the N-terminal 6xHis tag, the only difference being two rounds of PCR using two different reverse primers for the incorporation of the stuffer fragment sequence at the C-terminus. First round of PCR was done using reverse primer 5’-TGCCGACTTATTGAAATGTGCACCAGCAGTCAGTGTTGAGATGATGCTTTGACAAAAGG-3’ with deep vent (NEB) at 45°C and second round of PCR was done using reverse primer 5’-TATACTAAGCTTTCAGTTGTTATATTTGTTTGCGCCTGCCGACTTATTGAATGTGC-3’at 42°C. Forward primer used and rest of the procedure was, same as in N-terminal His-tagged native IL2.

Cloning of C-terminal His-tagged native IL2 was done using forward primer 5’-TATACTACCCATATGGCACCTACTTCAAGTTCTACAAAGAAAACACAGC-3’ and the reverse primer 5’-TATACTACAAGCTTTCAGTGATGGT GATGGTGATGAGTCAGTGTTGAGATGATGC -3’using deep vent (NEB) at 44°C and digested with the restriction enzymes Nde I and Hind III for subcloning into pET-23a, for production in BL21DE3pLysS. Cloning was done in XL-1 Blue cells, whereas protein expression was done in BL21DE3pLysS. pLysS vector contains chloramphinicol resistant marker. The product has a methionine at the N-terminus, derived from the NdeI restriction site.

Similarly, cloning of C-terminal His-tagged IL2 with stuffer fragment at N-terminal was done, the difference being two rounds of PCR using two different forward primers for the incorporation of the stuffer fragment sequence at N-terminus. First round of PCR was done using forward primer 5’-TCAAAGAATTTCCACGCGGGCGCAGCACCTACTTCAAGTTCTACAAAGAAAACACAGC-3’ using deep vent (NEB) at annealing 45°C and second round of PCR was done using forward primer 5’-ATATACTCATATGAACAACTATAAAAACGCAGGAGCTTCAAAGAATTTCCACGCGGG-3’at annealing 40°C. Reverse primer used and rest of the procedure was same as in N-terminal His-tagged native IL2.

IL2 Variants designed to electrostatically reengineer nose-tail docking. Charge-alteringvariants were made using the Quick Change site directed mutagenesis kit (Stratagene). N-terminal His-tagged native IL2 cloned in pQE30 vector was used as the template. The sequences of the primers used for introducing various point mutations are given below:

Forward and reverse primers for E52Q mutation: 5’- CCCAAGAAGGCCACACA ACTGAAACATC -3’ and 5’- GAAGATGTTTCAGTTGTGTGGCCTTC -3’

Forward and reverse primers for E52K mutation: 5’- CCCAAGAAGGCCACAAA ACTGAAACATC -3’ and 5’- GAAGATGTTTCAGTTTTGTGGCCTTC -3’

Forward and reverse primers for E95Q mutation: 5’- CGTAATAGTTCTGCAAC TAAAGGGATC-3’ and 5’- AGATCCCTTTAGTTGCAGAACTATTACG -3’

Forward and reverse primers for E95K mutation: 5’- CGTAATAGTTCTGAAAC TAAAGGGATC-3’ and 5’- AGATCCCTTTAGTTTCAGAACTATTACG -3’

Forward and reverse primers for E100Q mutation: 5’- CTGGAACTAAAGGGAT CTCAAACAACATTCATG-3’ and 5’- CACACATGAATGTTGTTTGAGATCC CTTTAGTTCC -3’

Forward and reverse primers for E100Q mutation: 5’- CTGGAACTAAAGGGAT CTAAAACAACATTCATG-3’ and 5’- CACACATGAATGTTGTTTTAGATCC CTTTAGTTCC -3’

The primer-extension was done with Pfu Turbo polymerase (stratagene) at 55°C annealing temp. Products obtained were digested with the enzyme, Dpn1, to remove parental (template) copies of the plasmid and were transformed in XL-1 Blue cells. The mutations were confirmed by DNA sequencing and the expression was done in M15pRep4.

IL2 variants disulfide mutants and helix topology scrambling variants. The disulfide mutant IL2 and the scrambled IL2 genes were obtained inserted in a cloning vector pUC57 from Genescript in the form of lyophilized powder (~4µg) and was suspended in TAE buffer to make a 50ng/ µl solution. The genes were fished out by PCR using forward primer 5’-TATACTACTGGATCCGCGCCGACCTCTTCTTCTACC-3’ and the reverse primer 5’-AATTATACTAAGCTTCTAGGTCAGGGTAGAGATGATAGACTG AG-3’, with PCR extender system (eppendorff), at annealing 55°C and digested with the restriction enzymes BamHI and HindIII for subcloning into pQE30. Transformation, sequencing and expression were done as described earlier.

Verification of identities of IL2 and its variants

DNA. The positive clones obtained were sequenced on an Applied Biosystems DNA sequencer (3130 XL analyzer), for performing automated DNA sequencing. Plasmids were purified from XL-1 Blue cells using the Qiagen MiniPrep kit. The correct DNA sequence, established the identity of IL2 and its variant forms, cloned in the desired vectors.

Protein. The identity of native IL2 was established through examination of molecular weight by SDS-PAGE, as well as MALDI-TOF-based peptide mass fingerprinting.Protein sample was reduced, alkylated, trypsinised and then guanidated. MALDI-TOF-based peptide mass fingerprinting of IL2 was done using Applied Biosystems Voyager DE-STR mass spectrometer, in the reflector mode with a sufficiently high resolution, offering sub-Dalton accuracy of determination of the masses of tryptic peptides. Sample ionization was assisted by the matrix, -cyano, 6-hydroxy cinnamic acid (CHCA). A total of 8 out of 15 expected tryptic peptides were detected, covering almost 80% of the sequence of native IL2 [supplementary figure (panel C)]. The diagnostic masses detected were all within 1 Da of the following expected masses: 2767.198, 2684.877, 2662.94, 2593.59, 1624.9, 1569.784, 939.088 and 602.738.