Supplementary Figures:

Figure S1: Sequence analysis of the amplified fragment of MrNV RNA2 using RNA 2.1 primers. The sequence of the MrNV RNA2 fragment (Malaysian isolate) was compared with the published sequence of the gene, where it showed 98% identity with the China isolate (AY231437.2).

Figure S2: Summary of variable sites of 16 observed Nodavirus RNA2 haplotypes. Dots indicate identity with the Hap1 haplotype sequence. The vertical axon shows the number of haplotypes and the horizontal one shows the number of nucleotides.

Figure S1

Figure S2

Supplementary Tables:

Table S1: Primers for the detection of M. rosenbergii nodavirus (MrNV) and XSV using RT-PCR.

Table S2: Detection of MrNV and XSV associated with WTD in the Malaysian M. rosenbergii.

Table S3: Pairwise distance between the samples.

Table S4: Hierarchical analysis of the molecular variance (AMOVA) among populations without consideration of outgroups.

Table S5: Hierarchical analysis of the molecular variance (AMOVA) among populations of Macrobrachium rosenbergii with consideration of outgroups.

Table S1: Primers for the detection of M. rosenbergii nodavirus (MrNV) and XSV by RT-PCR.

Gene / Accession Number / Sequence (5´ to 3´) / Expected product size (bp)
RNA 2.1 / AY222840 / Forward
Reverse / AGGCAGGCTACGTCACAAGT
ACAACCTAATTATTGCCGAC / 646
RNA 2.2 / AY222840 / Forward
Reverse / ATGGCTAGAGGTAAACAAAATTC
ACAACCTAATTATTGCCGAC / 1114
XSV / FJ379532 / Forward
Reverse / GGAGAACCATGAGATCACG
CTGCTCATTACTGTTCGGAGT / 500

Table S2: Detection of MrNV and XSV associated with WTD in the Malaysian M. rosenbergii.

Location / Total samples / No. of samples with whitish muscle coloration / No. of positive samples of MrNV using RT-PCR / No. of positive samples of XSV using RT-PCR / Histopathologicala result based on clinical signs
Farm.A
(Negeri Sembilan) / 10 / 3 / 3 / 2 / +++
Sungai Timun
(Negeri Sembilan) / 10 / 2 / 4 / 0 / -
Sungai Perak
(Perak) / 10 / 3 / 5 / 0 / ++

a Pathological lesions were found in the both tail muscle tissue and hepatopancreas of the samples.

(+++): Sever nectrotic changes

(++): Moderate nectrotic changes

(+): Mild nectrotic changes

(-): No significant finding

Table S3: Pairwise distance between the samples.

Locations / 1* / 2* / 3* / 4*
Farm A (Mun)
Sg.Timun / 0.046
Sg.Perak / 0.051 / 0.014
Outgroups / 0.096 / 0.064 / 0.068

* 1=FarmA (Mun); 2=Sg. Timun; 3=Sg. Perak; 4=Outgroups

Table S4: Hierarchical analysis of the molecular variance (AMOVA) among populations without consideration of outgroups.

Source of variation / d.f.1 / Sum of squares / variance components / percentage of variation
Among populations / 2 / 19.217 / 0.34823 Va / 4.05
within populations / 9 / 74.200 / 8.24444 Vb / 95.95
Total / 11 / 93.417 / 8.59267

Fixation Index FST: 0.04053; P-Value: 0.21

1 d.f: Degree of freedom

2 Va: Variance a

3 Vb: Variance b

Table S5: Hierarchical analysis of the molecular variance (AMOVA) among populations of Macrobrachium rosenbergii with consideration of outgroups.

Source of variation / d.f.1 / Sum of squares / variance components / percentage of variation
Among populations / 6 / 148.967 / 8.49375 Va / 52.45
within populations / 13 / 100.083 / 7.69872 Vb / 47.55
Total / 19 / 249.050 / 16.19247

Fixation Index FST: 0.52455; P-Value: 0.00098

1 d.f: Degree of freedom

2 Va: Variance a

3 Vb: Variance b

4