A Practical System for High Throughput Screening of Mutants of Bacillus Fastidiosus Uricase

Supplementary Material for

A practical system for high throughput screening of mutants of Bacillus fastidiosus uricase

Tao Feng1,a, Xiaolan Yang1,a, Deqiang Wang1, Xiaolei Hu1, Juan Liao2, Jun Pu1, Xinyun Zhao3, Chang-Guo Zhan3, Fei Liao1,*

1Unit for Analytical Probes and Protein Biotechnology, Key Laboratory of Medical Laboratory Diagnostics of the Education Ministry, College of Laboratory Medicine, Chongqing Medical University, No.1, Yixueyuan Road, Chongqing 400016, P.R. China;

2Central Laboratory, Yongchuan Hospital, Chongqing Medical University, No.439, Xuanhua Road, Yongchuan, Chongqing 402160, China;

3Molecular Modeling and Biopharmaceutical Center and Department of Pharmaceutical Sciences, College of Pharmacy, University of Kentucky, 789 South Limestone Street, Lexington, KY 40536, U.S.A.

______

a These authors contributed equally to this work.

*Corresponding author: ; ;

Tel/Fax, +86-23-68485240,

Fig. S1 Uric acid molar extinction coefficient at selected wavelengths

Fig. S2 Uricase reaction curves recorded at different wavelengths

The reaction curves were recorded in the same reaction mixtures concomitantly at the selected three wavelengths with Biotek EON microplate reader through swift change of the selected wavelengths. Arrow indicated noise to distort the smoothness of reaction curve.

Fig. S3 The distribution of the initial absorbance at selected wavelengths

a. 293 nm; b. 298 nm; c. 302 nm

Fig. S4 Effects of lysis periods on uricase activities in cell suspension

The lysis buffer was 1.0 M Tris-HCl at pH 9.0 plus 0.1% Tween-20 and 1.0 mM 4-aminobenzamidine. Lysis efficacy was reflected by uricase activity in cell suspension considering 1: 9 volume ratio of cell suspension to the lysis buffer.

Fig. S5 Effects of MnCl2 concentration on the yield of PCR products

A: 0.5 mM MnCl2 treatment; B: 1.0 mM MnCl2 treatment; C: 1.5 mM MnCl2

treatment; D: 2.0 mM MnCl2 treatment; E: 2.5 mM MnCl2 treatment.

Fig. S6 sequence alignment of the mutant L171I/Y182F/Y187F/A193S against the wildtype uricase

Fig. S7 Estimation of molecular weight of the mutant, comparison of solubility of the mutant L171I/Y182F/Y187F/A193S and the wildtype uricase

(a)  SDS-PAGE estimation of molecular weight of the active mutant.

M: Marker; A: the wildtype uricase; B: the mutant L171I/Y182F/Y187F/A193S.

(b) SDS-PAGE analysis of precipitates and supernatants of cell lysates.

M: Marker; A: the wildtype uricase in precipitates; B: the wildtype uricase in supernatant; C: the mutant L171I/Y182F/Y187F/A193S in precipitates; D: the mutant L171I/Y182F/Y187F/A193S in supernatant.

(c) images of precipitates in ependorf tubes before and after centrifugation.

The turbidity of cell lysates before and after centrifugation at 4,000 rpm for 10 min.

Fig. S8 Thermoinactivation process of mutant L171I, Y182F, Y187F, and A193S, at pH 7.4 and 37 °C

Table S1. Molecular cloning properties of amino acid residues at the N-terminus

Mutation region / Primes / Digestion site
A1-V150 / Forward-primer 5’- ACAATTCCCCTCTAGAAATAAT -3’ (the sequence was those in the vector) / XbaI
Reverse-primer 5’-CTTCTGTTCCGCTAGCAGTACG-3’ (R152-E158; the first base was form V159; the reversed direction) / NheI

Table S2. Effects of initial substrate concentration on uricase activity estimated by different methods (n = 10, mean ± SD)

Methods / Substrate concentration (μM)
50 μM / 100 μM / 150 μM / 200 μM / 300 μM
Initial rates (min-1)* / 0.52 ± 0.04 / 0.97 ± 0.03 / 1.29 ± 0.06 / 1.64 ± 0.05 / 1.86 ± 0.04
Vm/Km** / 0.13 ± 0.01 / 0.13 ± 0.01 / 0.13 ± 0.01 / 0.13 ± 0.01 / 0.12 ± 0.01
Cells after amplifications for 7 h at 37 °C and induced expression at 16 °C for 18 h were lyzed by sonication treatment at 5-s intervals for 10 min; the supernatant was collected by centrifugation at 1625 × g for 5 min, and diluted by 5 times before activity assay. Uricase reaction curve was recorded at 298 nm in 60 min. Only absorbance below 1.500 was analyzed. For comparison, the same reaction curve was analyzed by different methods. Initial rate was estimated as the average absorbance change rate within the first 6.0 min. * There were significant effects of substrate concentration on initial rates by F-test (P < 0.01). ** There were no difference in Vm/Km at different substrate concentration (P = 0.329).

Table S3. Effects of methods of cell lysis of independent monoclones on CVs of uricase activities (n = 48)

Paired mutants and the strategy for cell lysis / CVs of activities of uricase in cell suspension (%)
1.8-fold ratio / 3.3-fold ratio
The staring material / L322D-SN-6His / The staring material / E2R/L322D-SN-6His
Alkaline buffer / 39.8 / 33.2 / 34.4 / 25.9
Sonication treatment / 16.3 / 11.9 / 19.3 / 13.0
A total of 48 individual clones of each vector were picked and inoculated in 48-well microplates for amplification of 12 h in 0.60 mL TB medium; then 1.0 mM final IPTG was added for induced expression in HTP mode. Finally, two lysis methods were compared. In detail, for HTP lysis with the alkaline buffer, 20 mL cell suspension from each well was withdrawn for mixing with 180 mL lysis buffer (1.0 M Tris-HCl at pH 9.0 plus 0.1% tween-20 and 1.0 mM 4-aminobenzamidine) in 96-well microplates for continuous agitation under room temperature for 9.0 h. Uricase activity was determined as Vm/Km directly in cell lysates prepared via alkaline HTP lysis without dilution, while after dilution by 1:2 in cell lysates prepared via sonication treatment.

Table S4. Effects of steps for HTP lysis of cells on CVs of activities of the starting uricase estimated as Vm/Km with reaction curve recorded in 30 min (n = 48)

Steps / Activity assay a / HTP lysis b / Induced expression c
CV / 3.0 / 6.0 / 16.0
a.  The same cell lysate prepared by sonication treatment was determined, with the lysis ratio of 1:29 for cell suspension to the lysis buffer (Tris-HCl buffer at 1.0 M and pH 9.0 plus 0.1% tween-20 and 1.0 mM p-aminobenzamidine).
b.  The same cell suspension was repeatedly lyzed in HTP mode for 8 h with 1:19 ratio to the lysis buffer.
c.  The same cell suspension was amplified in a glass for 8 h at 37 °C and then aliquots of 0.60 mL suspension were divided into 48-well microplates. Afterwards, IPTG at final 1.0 mM was added for induced expression at 16 °C for 18 h. From each well, 20 mL cell suspension was withdrawn for mixing with the lysis buffer at 1:19 in 96-well microplates for continuous agitation under room temperature for 9.0 h. Finally, uricase activity in each well was determined as described in context with 96-well microplate with BioTek EON to record the absorbance at 298 nm.

Table S5. Cut-off for recognition of the starting material as a positive mutant over E2R/L322D-SN-6His with 3.3 fold higher specific activity (n = 48)

methods / cutoff (Vm/Km) / universal equivalency / sensitivity / specificity / Youden Index
Maximum of Youden Index / 0.018 / mean plus 3.6-fold SD / 0.872 / 1.000 / 0.872
Sensitivity 90% / 0.013 / mean plus 1.4-fold SD / 0.915 / 0.936 / 0.851
Sensitivity 80% / 0.021 / mean plus 4.9-fold SD / 0.809 / 1.000 / 0.809
A total of 48 monoclones for each vector were picked, inoculated, amplified, and induced for expression in HTP mode as descried in context. From each well after induced expression, 20 mL cell suspension was withdrawn and mixed with 180 mL of the alkaline lysis buffer in 96-well microplates for lysis in 9.0 h under room temperature. Only cell lysate of the starting material was diluted by 1:4 with 0.20 M sodium borate buffer at pH 9.2 before activity assay. Finally, 20 mL cell lysate was mixed with 180 mL substrate in 0.20 M sodium borate buffer at pH 9.2 for recording reaction at 298 nm, in 150 min.

Table S6a. Mutation spectrum of epPCR reaction with final 1.5 mM MnCl2 after pMD19-T vector ligation (n = 20)

Type / Mutation rates
Number (n) / Percentage (%)
Total mutations / 124 / 100
Transitions / 44 / 35.5
A→G＆T→C / 24 / 19.4
G→A＆C→T / 20 / 16.1
Transversions / 76 / 61.3
A→T＆T→A / 51 / 41.1
A→C＆T→G / 10 / 8.1
G→C＆C→G / 1 / 0.8
G→T＆C→A / 14 / 11.3
Deletion a / 4 / 3.2
Clones sequenced b / 20
Nucleotides Sequenced / 3,553
Total 20 clones were picked out from a kanamycin selective plate and then culture in 1-mL LB medium at 37 °C and 200 rpm overnight, and then sequenced.
a Total 4 cytidylic acid deletion, three of them come from one single clone (number 15) and the others comes from another clone (number 17).
b one of sequenced clone was a negative clone that exclude the coding sequence of uricase.

Table S6b. Mutation spectrum of epPCR reaction with final 1.5 mM MnCl2 after pET28a vector ligation (n = 20)

Type / Mutation rates
Number (n) / Percentage (%)
Total mutations / 49 / 100
Transitions / 16 / 32.6
A→G＆T→C / 6 / 12.2
G→A＆C→T / 10 / 20.4
Transversions / 33 / 67.4
A→T＆T→A / 22 / 44.9
A→C＆T→G / 9 / 18.4
G→C＆C→G / 0 / 0
G→T＆C→A / 2 / 4.1
Clones sequenced / 6
Nucleotides Sequenced / 1,122

Table S7. Mutation spectrum of epPCR reaction with final 0.5 mM MnCl2 (n = 10)

Type / Mutation rates
Number among sequenced clones (n) / Percentage (%)
Total mutations / 5 / 100
Transitions / 2 / 40
A→G＆T→C / 2 / 40
G→A＆C→T / 0 / 0
Transversions / 3 / 60
A→T＆T→A / 2 / 40
A→C＆T→G / 0 / 0
G→C＆C→G / 1 / 20
G→T＆C→A / 0 / 0
Clones sequenced / 10
Nucleotides Sequenced / 3, 864

In general, high mutation rates are not recommended for epPCR because they often lead to inactive mutants. For comparison, a low mutation rate was further tested with the same fragment for epPCR with final 0.5 mM MnCl2. Among 10 monoclones sequenced, just three clones harbored mutagenesis while others belonged to wild-type uricase In the resulted individual clones, there were a total of 5 mutations causing substitution of amino acid residues and thus a mutation rate of 0.3%, comparable to the recommend mutation rates for directed evolution.9-11 By screening via the estimation of Vm/Km of 400 clones, there were more than 40% active clones and about 10% positive clones according the stated cutoff, but were ultimately found to harbor no mutation at all.

Table S8. Comparison of properties of the mutant (L171I/Y182F/Y187F/A193S) and the staring wildtype uricase

Enzyme / Wild-type / L171I/Y182F/Y187F/A193S
Oligomer state / 4 / 4 + 2
Specific activity (kU/g) / 6.8 ± 0.3 / 8.3 ± 0.3
pH / pH 7.4 / pH 9.2 / pH 7.4 / pH 9.2
Km (mM) / 2.50 / 0.31 / 1.10 / 0.27
Half-life (day) / 22 ± 2 / 43 ± 3 / 0.3 ± 0.02 / 15 ± 4

Km at pH 7.4 was approximated by the following method with two uric acid concentrations at 0.20 and 0.40 mM to get the calibrated apparent specific activities [S1, S2].

S1. Atkins, G. L., I. Nimmo, A.A (1981) comment on the design of experiments to estimate the Michaelis-Menten parameters of enzyme-catalysed reactions. Experientia. 37: 122-123.

S2. Liao, F., Yang, X., Zou, Q., Zeng, Z. Zuo, Y. (2003) Fast estimation of Michaelis-Menten constant of arylesterase with a pair of medium concentrations of substrate. J Med Coll PLA. 18: 312-316.

13