Supplementary Materials
Gene expression profiling by mRNA sequencing reveals increased expression of immune/inflammation-related genes in hippocampus of individuals with schizophrenia
Supplementary Table 1. Primers used for qRT-PCR validation
Gene / Primer F / Primer RAPOL1 / AGGCCAGGAAAAGAAAGAGC / TCTTCGGAGGACATTGAACC
IGFBP4 / GGTGGGAAGAAAGAATGCAA / TCATGGCTGTGACCACAAAT
ADORA2A / CTTGGGTTCTGAGGAAGCAG / TGCTCTGTGGAGACAAGGTG
CD163 / CAGATTGGTCCAGAGCCTTC / ATTTGGAAATGAGGCTGACG
IFITM2 / CATCATCATCCCAGTGTTGG / GATAAAGGGCTGATGCAGGA
IFITM3 / CAAGGAGGAGCACGAGG / TTGAACAGGGACCAGACG
Supplementary Table 2. Antibodies used for immunohistochemistry
Primary Antibody / Company / dilution / Secondary antibodyS100A8 (MRP-8) / Abcam (ab19860), Cambridge, MA / 1:500 / Anti-mouse, 1:100; Vector Labs
S100A9 / Abcam (ab24111), Cambridge, MA / 1:400 / Anti-mouse, 1:100; Vector Labs
CD163 / Abcam (ab111250), Cambridge, MA / 1:400 / Anti-mouse, 1:100; Vector Labs
HP / Abcam (ab133764), Cambridge, MA / 1:400 / Anti-mouse, 1:100; Vector Labs
APOL1 / Abcam (ab81598), Cambridge, MA / 1:800 / Anti-mouse, 1:100; Vector Labs
ADORA2A / LSBio (LS-B2122), Seattle, WA / 1:800 / Anti-mouse, 1:100; Vector Labs
Supplementary Table 3. RNA-Seq mapping statistics
Sample ID / Disease status / Read length (bp) / Total reads / Total mapped reads1 / Uniquely mapped reads1C33 / Schizophrenia / 53 / 53197756 / 49137942 / 44441582
C37 / Schizophrenia / 53 / 71173880 / 68348579 / 56532359
C38 / Schizophrenia / 53 / 69701862 / 63843250 / 56971953
C39 / Schizophrenia / 53 / 56569086 / 48915145 / 40707221
C1 / Schizophrenia / 53 / 70564318 / 67383359 / 59366190
C58 / Schizophrenia / 53 / 57634936 / 55860493 / 46351361
C3 / Schizophrenia / 53 / 63705066 / 60110306 / 50777608
C4 / Schizophrenia / 53 / 62101082 / 56331550 / 47773626
C8 / Schizophrenia / 53 / 66136788 / 61571661 / 54142968
C9 / Schizophrenia / 53 / 57889956 / 51345764 / 45577910
C16 / Schizophrenia / 53 / 62898150 / 60185882 / 54240153
C17 / Schizophrenia / 53 / 56502040 / 52826410 / 47121556
C23 / Schizophrenia / 53 / 63316256 / 60536218 / 51577572
C31 / Schizophrenia / 53 / 72888254 / 70027638 / 64541704
C40 / Normal / 53 / 62817780 / 56170654 / 51367527
C41 / Normal / 53 / 61507178 / 56909081 / 52189292
C42 / Normal / 53 / 63446588 / 55926842 / 50554178
C45 / Normal / 53 / 68427656 / 64362298 / 58423745
C47 / Normal / 53 / 65493458 / 61446466 / 54930505
C49 / Normal / 53 / 57244548 / 50927421 / 46435428
C51 / Normal / 53 / 48335126 / 44305617 / 38347390
C52 / Normal / 53 / 61726674 / 56935450 / 51761301
C54 / Normal / 53 / 48149310 / 42706671 / 37294733
C59 / Normal / 53 / 62582318 / 58895975 / 54169173
C60 / Normal / 53 / 69426734 / 66681589 / 58064656
C13 / Normal / 53 / 64920926 / 57771194 / 52085864
C19 / Normal / 53 / 56648888 / 51644482 / 46430687
C21 / Normal / 53 / 67793494 / 64479925 / 57626438
C26 / Normal / 53 / 73100772 / 69094809 / 64471961
Mean / 62617272 / 58092506 / 51526781
1Mapping to a reference genome (hg18)
Supplementary Table 4. Differentially expressed genes in the hippocampus between schizophrenia and controls
Gene / log FC1 / log CPM2 / P Value / FDRSHOX2 / -4.134 / 1.40393 / 8.26E-07 / 0.00127
DEFB1 / -3.6669 / -1.0033 / 0.00023 / 0.03609
CHRNA2 / -2.6276 / 3.52897 / 3.38E-08 / 0.00029
CCL4 / -2.461 / -0.0408 / 8.89E-06 / 0.00684
PPP1R17 / -2.1828 / 1.29228 / 9.54E-06 / 0.00703
LOC392364 / -2.1667 / 1.68289 / 0.00032 / 0.04276
PVALB / -1.7382 / 3.99506 / 5.82E-06 / 0.00552
GABRQ / -1.6104 / 2.70947 / 0.00012 / 0.03044
SLC17A6 / -1.5365 / 3.30388 / 0.00024 / 0.03732
CHRNA6 / -1.3727 / 0.11257 / 0.0002 / 0.035
OLR1 / -1.2783 / 3.40811 / 6.20E-06 / 0.00552
B3GAT2 / -1.18 / 1.55681 / 0.00021 / 0.035
PTGS1 / -1.0235 / 4.45562 / 0.00032 / 0.04349
EDIL3 / -0.9266 / 7.07004 / 2.30E-05 / 0.01256
AMACR / -0.9256 / 0.95069 / 0.00018 / 0.035
ACVR1C / -0.7612 / 5.36553 / 0.00036 / 0.04442
ZNF649 / -0.5121 / 3.30955 / 0.00039 / 0.04686
SEMA3C / -0.4844 / 4.86279 / 0.00012 / 0.03069
SPOCK3 / -0.4362 / 7.66843 / 0.0003 / 0.04164
INSIG1 / -0.4308 / 6.53975 / 0.0003 / 0.04164
SQLE / -0.4084 / 5.8044 / 0.00027 / 0.04059
FARP1 / 0.40557 / 6.34202 / 0.00015 / 0.03413
WIZ / 0.40709 / 6.02637 / 0.0002 / 0.035
TBKBP1 / 0.42808 / 5.91509 / 0.00036 / 0.04442
HSD11B1L / 0.45456 / 6.0402 / 0.00011 / 0.02955
SLC9A3R2 / 0.45708 / 6.18503 / 0.00036 / 0.04442
PALM / 0.46443 / 8.51646 / 0.0002 / 0.035
REXO1 / 0.46677 / 6.36596 / 0.00019 / 0.035
FEZF2 / 0.49663 / 6.06064 / 0.00033 / 0.04426
HSP90AB2P / 0.50156 / 7.01474 / 0.00019 / 0.035
ZNF814 / 0.50909 / 4.75379 / 0.0002 / 0.035
FAM189A1 / 0.51045 / 6.5357 / 0.00016 / 0.03413
SHC2 / 0.51116 / 5.88049 / 0.00021 / 0.035
DOCK6 / 0.51247 / 3.95724 / 0.00038 / 0.04685
MEG3 / 0.52676 / 8.42236 / 0.00035 / 0.04442
RBMS2 / 0.53434 / 4.85546 / 0.00018 / 0.035
ADRA2C / 0.5485 / 2.93974 / 0.00021 / 0.035
SAMD14 / 0.54855 / 5.11712 / 7.80E-05 / 0.02448
NID1 / 0.54879 / 3.71136 / 0.00035 / 0.04442
PDGFRB / 0.55117 / 5.98505 / 5.00E-05 / 0.02067
AP1G2 / 0.57598 / 5.27501 / 0.00018 / 0.035
ESRG / 0.60049 / 3.87476 / 0.00012 / 0.03069
RAB13 / 0.61127 / 5.19036 / 0.00018 / 0.035
RRAS / 0.62391 / 3.94002 / 0.00021 / 0.03552
PSMB8 / 0.63187 / 3.90561 / 0.00014 / 0.03304
TNFRSF25 / 0.63488 / 4.26293 / 0.0002 / 0.035
IFI27 / 0.63656 / 5.30481 / 0.00028 / 0.04103
BST2 / 0.64277 / 4.26471 / 0.00021 / 0.035
EHD2 / 0.65149 / 4.99079 / 0.00011 / 0.02993
ADAM33 / 0.6516 / 3.3551 / 0.00026 / 0.03938
HIGD1B / 0.65737 / 3.25471 / 0.00017 / 0.03413
C19orf81 / 0.6607 / 4.26598 / 3.63E-05 / 0.01617
MALL / 0.66105 / 2.61499 / 0.00028 / 0.04103
ADORA2A / 0.66412 / 3.49438 / 6.82E-05 / 0.02326
KANK3 / 0.66765 / 3.98842 / 9.75E-05 / 0.02849
GFOD1 / 0.67098 / 5.5982 / 0.00036 / 0.04442
PECAM1 / 0.67704 / 5.75871 / 7.18E-05 / 0.02386
NPIP / 0.69012 / 7.05571 / 9.12E-07 / 0.00129
ALPL / 0.69101 / 4.63177 / 0.00011 / 0.02955
LOC440896 / 0.69379 / 5.90964 / 0.00039 / 0.04686
TBX2 / 0.69781 / 3.74265 / 7.60E-05 / 0.02429
XAF1 / 0.7034 / 5.39334 / 0.00034 / 0.04442
A4GALT / 0.70445 / 2.37347 / 9.27E-05 / 0.02757
ZGLP1 / 0.71856 / 2.47903 / 0.00024 / 0.0375
ADCY4 / 0.72005 / 2.91393 / 0.0002 / 0.035
TMEM204 / 0.7292 / 3.61589 / 0.00012 / 0.03044
MIR143HG / 0.74754 / 4.57005 / 6.07E-05 / 0.02236
GNB3 / 0.75408 / 2.50405 / 0.00025 / 0.03783
STAP2 / 0.76549 / 1.52351 / 0.0001 / 0.02873
POU2F2 / 0.76855 / 3.70034 / 0.00014 / 0.03296
LOC100130872 / 0.78018 / 1.6114 / 5.98E-05 / 0.02236
TINAGL1 / 0.78853 / 4.16838 / 4.49E-05 / 0.01953
PLEKHG2 / 0.79169 / 3.68271 / 8.15E-05 / 0.0251
HYAL2 / 0.79261 / 4.4053 / 5.31E-05 / 0.02114
HEYL / 0.79416 / 3.37629 / 0.0002 / 0.035
FSTL3 / 0.79504 / 3.82024 / 0.00016 / 0.03413
NDUFA4L2 / 0.7982 / 5.06859 / 5.36E-05 / 0.02114
GGT5 / 0.80031 / 4.60801 / 3.36E-05 / 0.01539
ACVRL1 / 0.81139 / 4.25993 / 2.12E-05 / 0.01238
MTRNR2L1 / 0.82394 / 9.02196 / 0.00031 / 0.04244
MIRLET7BHG / 0.82659 / 2.78938 / 0.00013 / 0.03124
MIR4461 / 0.8357 / 8.82395 / 0.00011 / 0.02955
PKN3 / 0.83728 / 1.93065 / 0.00023 / 0.03609
OXTR / 0.84232 / 2.68586 / 8.64E-05 / 0.02614
SLC25A41 / 0.84636 / 2.36489 / 0.00029 / 0.0415
MTRNR2L8 / 0.84738 / 11.3364 / 6.87E-05 / 0.02326
COL4A2 / 0.85504 / 5.67182 / 1.39E-05 / 0.00983
FGR / 0.85898 / 2.74299 / 2.98E-05 / 0.01487
PRIC285 / 0.86046 / 2.84718 / 0.00014 / 0.03263
SEC1 / 0.86155 / 0.42803 / 0.00042 / 0.04963
FGF17 / 0.86379 / 2.19717 / 0.00022 / 0.03552
FBLIM1 / 0.87165 / 3.46129 / 0.00035 / 0.04442
BATF2 / 0.8733 / 1.11431 / 0.00041 / 0.04916
ACSL5 / 0.89666 / 4.17757 / 0.00016 / 0.03413
IGFBP4 / 0.89959 / 5.15182 / 8.37E-06 / 0.00675
PTH1R / 0.8997 / 4.58787 / 3.42E-07 / 0.00097
ANPEP / 0.90159 / 1.8135 / 3.32E-05 / 0.01539
MTRNR2L3 / 0.91093 / 5.83244 / 2.19E-05 / 0.01238
FTCD / 0.92546 / 2.60005 / 0.00012 / 0.03044
IFITM3 / 0.95474 / 7.28243 / 6.51E-06 / 0.00552
MTRNR2L6 / 0.95801 / 5.53614 / 0.00025 / 0.03783
COL4A1 / 0.9692 / 5.33494 / 2.12E-05 / 0.01238
GBP2 / 0.9789 / 3.35433 / 0.00042 / 0.04985
SLC5A9 / 0.98918 / 0.05869 / 0.00032 / 0.04276
SMAD6 / 0.99247 / 3.20792 / 0.00023 / 0.03609
KCNE4 / 0.99527 / 3.35839 / 0.00022 / 0.03609
BCYRN1 / 1.00776 / 7.50897 / 2.70E-05 / 0.01398
ITGA5 / 1.01711 / 3.641 / 0.00012 / 0.03044
TGM2 / 1.0425 / 6.04116 / 0.00016 / 0.03413
MTRNR2L2 / 1.04367 / 14.3672 / 6.44E-06 / 0.00552
APOL1 / 1.05545 / 3.92279 / 4.01E-06 / 0.00453
C20orf54 / 1.07354 / 2.29478 / 0.00029 / 0.04157
GJA4 / 1.08085 / 2.78077 / 7.38E-05 / 0.02404
C9orf84 / 1.08413 / -0.0459 / 6.36E-05 / 0.02246
PRB2 / 1.08892 / -0.0232 / 0.00036 / 0.04442
IFITM1 / 1.08895 / 5.65427 / 5.95E-06 / 0.00552
IFITM2 / 1.14951 / 5.33014 / 6.31E-07 / 0.00112
LOC151534 / 1.19027 / -0.9111 / 0.00035 / 0.04442
IL4R / 1.20922 / 3.87816 / 4.81E-05 / 0.02039
TNFSF14 / 1.24853 / -0.2834 / 0.00014 / 0.03296
LCN10 / 1.26167 / -0.6148 / 0.00028 / 0.04059
LYG2 / 1.28079 / -0.4531 / 0.00025 / 0.03783
HBA2 / 1.29322 / 4.8615 / 0.00021 / 0.035
EDN1 / 1.30054 / 3.5408 / 1.86E-05 / 0.01236
IL32 / 1.34194 / 3.10014 / 6.60E-07 / 0.00112
CD163 / 1.35513 / 1.63344 / 0.00035 / 0.04442
ADAMTS9 / 1.3575 / 3.85515 / 6.26E-05 / 0.02246
FLJ43860 / 1.46452 / -1.341 / 0.00029 / 0.04107
FCN3 / 1.49761 / -0.2135 / 3.12E-05 / 0.01509
LOC100133161 / 1.5126 / -1.156 / 5.62E-05 / 0.02165
HBB / 1.53561 / 7.05402 / 1.97E-05 / 0.01236
WFDC8 / 1.55118 / -1.3364 / 0.00016 / 0.03413
KLK3 / 1.65101 / -0.9294 / 0.00016 / 0.03413
SLCO4A1 / 1.71873 / 4.17368 / 3.79E-06 / 0.00453
HBA1 / 1.94842 / 4.54603 / 2.58E-06 / 0.00337
ALOX15B / 1.99853 / -0.497 / 4.79E-07 / 0.00102
H19 / 2.0011 / 1.24095 / 4.81E-07 / 0.00102
TNFRSF6B / 2.2984 / 0.05361 / 2.72E-05 / 0.01398
HP / 2.37691 / -0.3156 / 0.00017 / 0.035
CHI3L1 / 2.43269 / 6.12184 / 2.39E-07 / 0.00095
CXCL9 / 2.52647 / 0.17611 / 1.94E-05 / 0.01236
S100A9 / 3.33362 / 0.87919 / 2.80E-07 / 0.00095
CHI3L2 / 3.54846 / 4.97838 / 1.51E-07 / 0.00085
S100A8 / 4.21038 / 1.43228 / 1.62E-08 / 0.00027
1 log FC, the log fold change of genes, as compared to controls (positive log FC represents increase in schizophrenia); 2 log CPM, the average log2-counts-per-million
Supplementary Table 5. Correlation P-values between co-expression modules and traits
Module / Disease / Age / Sex / PMI / Brain pH / BMI / Smoking / Antipsychotics / RINM1 / 0.93 / 0.15 / 0.19 / 0.5 / 0.0675 / 0.246 / 0.978 / 0.27 / 0.50871
M2 / 0.1 / 0.74 / 0.35 / 0.17 / 0.0378 / 0.434 / 0.945 / 0.38 / 0.89714
M3 / 0.01 / 0.38 / 0.71 / 0.96 / 0.2007 / 0.235 / 0.37 / 0.16 / 0.096
M4 / 0.07 / 0.78 / 0.86 / 0.96 / 0.0004 / 0.608 / 0.569 / 0.02 / 0.04677
M5 / 0.15 / 0.67 / 0.94 / 0.06 / 0.0005 / 0.293 / 0.657 / 0.13 / 0.00063
M6 / 0.01 / 0.72 / 0.87 / 0.06 / 0.0934 / 0.092 / 0.778 / 0.51 / 0.0006
M7 / 0.83 / 0.49 / 0.79 / 0.57 / 0.3236 / 0.824 / 0.389 / 0.33 / 0.51355
M8 / 0.37 / 0.54 / 0.64 / 0.13 / 0.2561 / 0.127 / 0.179 / 0.8 / 0.21939
M9 / 0.21 / 0.44 / 0.76 / 0.82 / 0.0109 / 0.278 / 0.838 / 0.53 / 0.71486
M10 / 0.1 / 0.79 / 0.37 / 0.54 / 0.3265 / 0.008 / 0.399 / 0.66 / 0.00013
M11 / 0.04 / 0.56 / 0.75 / 0.86 / 0.0077 / 0.060 / 0.787 / 0.16 / 0.0123
M12 / 0.19 / 0.9 / 0.9 / 0.04 / 0.0091 / 0.307 / 0.25 / 0.02 / 0.00003
M13 / 0.02 / 0.35 / 0.7 / 0.04 / 0.1922 / 0.050 / 0.502 / 0.35 / 0.00001
M14 / 0.21 / 0.27 / 0.29 / 0.44 / 0.3073 / 0.621 / 0.083 / 0.85 / 0.24536
M15 / 0.76 / 0.21 / 0.14 / 0.77 / 0.0811 / 0.540 / 0.145 / 0.31 / 0.86576
M16 / 0.23 / 0.96 / 0.82 / 0.6 / 0.0006 / 0.536 / 0.191 / 0.55 / 0.50628
M17 / 0.06 / 0.31 / 0.84 / 0.71 / 0.3077 / 0.436 / 0.984 / 0.97 / 0.91719
M18 / 0.78 / 0.83 / 0.95 / 0.06 / 0.0041 / 0.292 / 0.192 / 0.13 / 0.45817
M19 / 0.04 / 0.82 / 0.9 / 0.31 / 0.0082 / 0.187 / 0.128 / 0.55 / 0.37742
M20 / 0.21 / 0.07 / 0.93 / 0.99 / 0.6685 / 0.560 / 0.023 / 0.86 / 0.18355
M21 / 0.6 / 0.41 / 0.9 / 0.01 / 0.7025 / 0.789 / 0.021 / 0.81 / 0.04728
M22 / 0.65 / 0.02 / 0.46 / 0.06 / 0.8708 / 0.187 / 0.025 / 0.28 / 0.30092
M23 / 0.3 / 0.96 / 0.67 / 0.01 / 0.7691 / 0.092 / 0.862 / 0.18 / 0.00045
PMI, post-mortem interval; BMI, body mass index; RIN, RNA integrity number
Supplementary Table 6. Correlation P-values between modules associated with schizophrenia and density of parvalbumin-containing neurons in the hippocampus
DG / CA4 / CA3 / CA2 / CA1 / SUBM3 / 0.061 / 0.160 / 0.368 / 0.096 / 0.020 / 0.909
M19 / 0.059 / 0.062 / 0.036 / 0.070 / 0.025 / 0.590
DG, dentate gyrus; SUB, subiculum
Supplementary Figure 1. Biological processes over-represented in genes in M3 module.
Supplementary Figure 2. Biological processes over-represented in the genes in M19 module.
Supplementary Figure 3. Photomicrographs of representative cells labeled by immunohistochemistry. S100A8 positively labeled cells in the lumen of a blood vessel (a) and in a capillary (b). S100A9 positively labeled cells in the lumen of a blood vessel (c) and in a capillary (d); CD163 label (e) and HP label (f) in endothelial cells of blood vessels; APOL1 labeled astrocytes adjacent to blood vessels (g) and ADORA2A labeled astrocytes (h) adjacent to the pial surface (arrow).
1