Biol309 Question Bank From DNA to Protein
Multiple Choice
1. During the process of translation:
A. the peptide is ‘passed’ from the tRNA in the P-site to the tRNA in the A-site.
B. incoming tRNAs must first bind to the E-site.
C. initiation begins with the binding of the ribosomal SSU to the poly-A tail of the mRNA.
D. the mRNA is translated by one ribosome at a time.
2. The presence of a poly-A tail on a RNA molecule indicates that:
A. there are exons present that must be removed.
B. this RNA molecule does not contain introns.
C. the transcript should be immediately degraded.
D. this is a rRNA molecule.
E. None of the above answers is correct
3. A ‘proteasome’ is a large structure in the cytoplasm that:
A. translates mRNA into proteinC. supercoils DNA
B. processes RNAD. enzymatically degrades proteins
4. During the processing of introns, a single snRNP complex catalyzes both the cleavage of the RNA and the joining of the cut ends. What would be the consequence if these two processes were catalyzed by separate enzymes not associated in a single complex?
A. the rate of RNA processing would be much faster.
B. the cell would be unable to identify the correct cleavage sites.
C. the exons might not be joined in the correct sequence.
D. exons instead of introns would be cleaved from the RNA molecule.
5. The nucleolus of the nucleus is the site where:
A. RNA processing occurs
B. rRNA is transcribed and ribosomal subunits are assembled
C. tRNA are charged with amino acids
D. mRNA is translated into protein
6. During "RNA processing"
A. all of the exons are removed and discarded
B. the RNA molecule is made from a DNA template.
C. introns are cut from the RNA and the exons are spliced together.
D. the RNA molecule is translated into a protein molecule.
7. How does the cell ‘mark’ the positions of introns in an immature RNA?
A. There is a special snRNP for each type of intron.
B. Codons called ‘cut’ and ‘paste’ (copyrighted by Microsoft) are present within the RNA.
C. It doesn’t need to, since the boundary between an intron and exon alternates frequently.
D. Special sequences are located near the splicing sites which are recognized by ribozymes.
8. “Alternative splicing” refers to:
A. the use of introns as exons, or vice versa, during RNA processing
B. splicing out of damaged DNA by DNA repair enzymes.
C. joining of RNA from two different genes to form a new mRNA.
D. the use of alternative reading frames when translating an mRNA.
E. a new dance for people with alternative life styles.
9. During transcription of DNA to RNA:
A. an RNA polymerase moves along the DNA in the 5’ to the 3’ direction.
B. the 3’ end of the RNA molecule is produced first.
C. an RNA polymerase must first bind to a promoter sequence.
D. transcription is always initiated at a “start codon.”
10. During the ‘elongation’ stage of translation, after the arrival of each new tRNA:
A. the amino acid is ‘passed’ from the tRNA in the A-site to the tRNA in the P-site.
B. newly arriving tRNAs must first bind to the E-site.
C. the peptide is ‘passed’ from the tRNA in the P-site to the tRNA in the A-site.
D. the new tRNA must first bind to the P-site of the ribozome.
11.During transcription of a particular gene,the RNA polymerase will transcribe:
A. both strands, but only one of RNA molecule will be used.
B. only one of the DNA strands, moving in a 3’ to 5’ direction along the template.
C. both strands, but moving 3’ to 5’ for one and 5’ to 3’ along the other.
D. only the exons of the gene while skipping over the introns.
12. Since the two strands of the DNA molecule are complementary, for any given gene:
A. The RNA polymerase can bind to either strand.
B. Only one strand actually carries the genetic code for a particular gene.
C. Each gene possesses an exact replica that can be used should a mutation occur.
D. A gene transcribed in the 5’ to 3’ direction on one strand can be transcribed in the 3’ to 5’ direction on the other strand.
13. In the genetic code there are:
A. more tRNAs than codons.C. more nucleotides than codons.
B. more codons than amino acids.D. the same number of codons and amino acids
14. Initiation of translation begins when the:
A. large and small subunits link together, then bind to the mRNA.
B. ribosomal small subunit holding an initiator tRNA binds to the 5’ end of the mRNA.
C. ribosome binds to the start codon and an initiator tRNA enters the ribosome.
D. initiator tRNA binds to the start codon, followed by binding of the ribosome large subunit.
15. A “TATA box” is
A. the translation termination sequence.
B. a base sequence in the promoters of eukaryotes and archaea.
C. facilitates assembly of the RNA polymerase II transcription complex.
D. an example of one of the translation stop codons.
16. According to the RNA-world theory:
A. RNA molecules were the first organic molecules formed on earth.
B. Life evolved on another planet called the “RNA World.”
C. All RNA molecules in cells are “ribozymes.”
D. Primitive RNA molecules evolved before protein and DNA
17. It seems probable that DNA contains thymine instead of uracil because:
A. thymine is chemically much more stable than uracil.
B. when uracil is chemically deaminated, thymine is produced.
C. thymine was one of the first four nucleotides in primitive RNA molecules.
D. if cytosine is deaminated, the altered base can be detected and removed.
True or False
1. Each of the 3 potential reading frames of an mRNA can produce a functional, but different, protein.
2. Transcription is terminated when the RNA polymerase encounters a poly-U sequence.
3. Translation ends when a ‘release factor’ protein binds to a stop codon.
4. Initiation of translation in prokaryotes involves binding of the sigma factor to a promoter.
5. Only rRNAs are polyadenylated.
6. Because genes can be coded on either strand of the DNA double helix, the coding regions of different genes can overlap.
7. Some antibiotics have selective effects upon prokaryotic ribosomes.
8. The promoter is located downstream from the coding region of a gene.
9. RNA processing, common in eukaryotes, does not occur in prokaryotes.
10. General transcription factors are proteins that regulate to eukaryotic RNA polymerase activity.
11. Ribozymes are primitive forms of RNA molecules that no longer exist in cells.
Fill in, etc
1. In a ribosome, the formation of the peptide bonds of the new peptide chain occurs in the ______subunit, whereas matching the codons of the mRNA are exposed on the surface of the ______subunit. During the peptide elongation stage of translation, each in-coming aminoacyl-tRNA binds to the ___-site of the ribosome, where as the growing peptide chain is held on the tRNA in the ___-site.
2. The end of translation is signaled by a ______codon, which binds a protein called the ______.
3. In bacteria, the protein called the ______associated with the RNA polymerase is principally responsible for binding to the promoter.
4.Place the following events in their correct sequence:
___ Translation
___ Transcription
___ Polyadenylation
___ Capping
___ RNA processing
___ Nuclear export
5. Identify and explain 3 lines of evidence that support the RNA World theory.
6. RNA molecules possess both genotype and phenotype:
A. The genotype of an RNA molecule is held in its ______.
B. What are two examples of phenotype properties of an RNA molecule?
7. Show and briefly explain how complementary base pairing can lead to replication of a strand of RNA with the following sequence: AUCGCGUUAACCGUA
8. ‘Wobble base pairing’ will occur for which one of the following pairs codons?
A. AUG and UGGC. GGA and GGC
B. AAA and UUUD. UAG and UGA
9. The codon for methionine is _____, the anticodon is _____, and the DNA code is ______.
10. Based upon the results of DNA sequencing for the Human Genome Project, the number of promoters suggests that there are around 25,000 genes in the human genome. However, the number of different types of proteins may actually be much higher than this. Why?
11. Introns are ‘junk’ DNA that create a burden on the species. Give at least two reasons why this statement is incorrect?
12. A research lab purified the messenger RNA for a mouse protein called ‘GFI’ and reverse transcribed it into cDNA. They then used the cDNA as a probe to locate the gene on the mouse chromosome, which they isolated and cloned. To their surprise the coding region of the GFI gene was 5500 bases longer than that of the cDNA. In an attempt to mass-produce the GFI protein, they transfected E. coli with double-stranded DNA derived from the cDNA, hoping that it could be produced in the bacteria, but the gene was not transcribed.
A. How would you explain the difference in size between the cDNA and genomic forms of the GFI gene?
B. How else does the cDNA differ from the original gene? (what are the different regions of a gene?)
C. What would you do differently to achieve transcription of the GFI gene in bacteria?
13. In the diagram to the right, label the three tRNA sites, codons and anticodons, peptide and mRNA. List the sequence of events that will occur when the in-coming tRNA sets into its binding site. Redraw the diagram as it will appear immediately after the next peptide bond is formed.
14. A particular gene codes for a mature mRNA containing 900 bases which is translated into a 40 Kd protein. A mutant form of the gene created by a single point mutation also yields an830-base mature mRNA yielding a 37 Kd protein with somewhat modified enzymatic activity. Analysis shows that the mutation has resulted in a 22 amino acid deletion within the protein. What is the most likely effect of the mutation? Explain.
Suppose a different point mutation also yields an830-base mRNA and a 37 Kd protein, but the protein is nonfunctional and is quickly degraded in the cytosol. What is the most likely effect of this mutation? Explain.
Use this table of codons to answer questions as needed
15. Working with an animal cell culture system, a researcher created random point mutations in the genes for the RNA polymerases. Individual cells with RNA polymerase mutations were isolated and used to generate a cell line that expressed that particular mutation. There was only one problem; she did not know which RNA polymerase was affected in each of the cell lines. To help resolve this question, she analyzed the levels of different RNAs expressed in each of the cell lines. The results she obtained are presented below.
Cell Line / RNA expression (%) relative to unmutated cellsHexose kinase / U4 snRNA / 18S rRNA / Tyrosine tRNA
Unmutated cells / 100 / 100 / 100 / 100
Cell line A / 100 / 30 / 98 / 40
Cell line B / 20 / 90 / 100 / 95
Cell line C / 98 / 96 / 43 / 100
Which type of RNA polymerase (I, II, or II) appears to be mutated in each one of the cell lines. Explain.
16.The following is a segment of DNA containing the beginning of a gene
3- GGCATACTTCAGTCAAGAGACATAG -5
5- CCGTATGAAGTCAGTTCTCTGTATC-3
A. If an RNA polymerase were to transcribe thegene from left to right, is the top or the bottom strand serving as the template?
B. What will be the sequence of the mRNA produced (be sure to label the 5 and 3 ends of your RNA molecule)?
C. What is the amino acid sequence of the peptide that would be translated from the mRNA. Label the N- and the C-terminus amino acids.
D. Which one of the following mutations would have the greatest effect on the structure of the protein? Explain.
a. deletion of the underlined ‘GC’ pair
b. substitution of TA pair for the underlined GC pair
17. A researcher studied the rate of synthesis for 3 proteins with molecular weights of 53 Kd ‘A’, 45 Kd ‘B’ and 25 Kd ‘C’ in cultured cells. To do so, they incubated the cells in culture medium containing 35S-methionine, which will become incorporated into and thereby label newly synthesized proteins. Separate cultures were incubated with the 35S-Met for 0, 2, 4, 6, and 8 minutes. After the incubation period, the cells were washed free of excess 35S-Met and homogenized to extract the protein, which was then separated by gel electrophoresis. Autoradiography was performed of the electrophoresed samples to show the amount of 35S-Met in the protein bands, and then the gel was stained with Coomassie Blue to determine the total amount of protein in the bands. The results of the autoradiagraphy and Coomassie Blue staining for the three proteins are shown in Figure 1. The amount of 35S-Met in the bands as calculated from the intensity of the bands in autoradiogram is graphed in Figure 2.
In a follow-up experiment, ‘pulse-chase’ labeling was performed. In this methodology, the cells are incubated for a brief time period with 35S-Met, and then incubated in medium with unlabeled methionine. Cultures were harvested at different times and analyzed as described above. The results of the autoradiography are shown in Figure 3.
A. Why does the labeling of proteins B and C increase in the first experiment?
B. Why does the labeling of the two proteins decrease in the second experiment? Would you expect this change to be most associated with spliceosomes, ribosomes, lysosomes or proteasomes? Explain.
C. How would you explain that the total amount of each protein remains the same?
D. What does the steady amount but absence of labeling of ‘A’ indicate about this protein?
18. The diagram below shows a mRNA molecule with various regions labeled:
A. What’s wrong with this diagram? Make a change that would fix it.
A. On the corrected diagram, identify by number the region(s) that is/are:
A. coding (i.e. contains codons that are part of the peptide) ____
B. non-coding____E. start codon ____
C. 3’ end ___F. stop codon ____
D. 5’ end ___G. ribosome binding site ____
B. Is this a prokaryotic or eukaryotic mRNA? Explain.
Biol 309Question BankDNA to Protein
Page 1