Table S2 Allele and Genotype Frequencies of Kiss-1 in Five Goat Breeds
Table S1 Primer sequences, amplified regions, product sizes and annealing temperatures used in analyses of the goat KiSS-1 gene
Primer name / Primers（5´ to 3´） / Amplified regions / Product size / Annealing temperatureKS1 / F: CAGGGAGACCTTGGAAAAGGT / Partial of exon2--exon3 / 2498/2518 bp / 58℃
R: TATCGCAGGCCGAAGGAGTT
KS2 / F: CTTGTGTTTGCTGGACAGTCT / Partial of intron 1 and exon 2 / 1101 bp / 64℃
R: TGCTCCCTCCCAACCTTCTT
KS3 / F: GCAGCGGGAGAAGGACGTGT / Exon 3 / 639 bp / 59℃
R: TGAATGGGGCAGCGGTCAGT
KS4 / F: TGGTTTGGGAAGGAGCAGCT / Intron 2 / 255/273 bp / 61℃
R: ACCCGCGTCCATGATCTCT
K3433 / F: CCCGCCTCACTCAGCCTCACC / Exon 3 / 403 bp / 66℃
R:GTCGACACCCTGCCCTGCTCC
K3688 / F:TGTCGACCTGCAGTTTGTGT / Exon3 / 198 bp / 62℃
R:GTCCTTCACCACGTCTAGTCT
Table S2 Allele and genotype frequencies of KiSS-1 in five goat breeds
Site / Breed / Jining Grey goat / Liaoning Cashmere goat / Inner Mongolia Cashmere goat / Boergoat / Wendeng dairy goat
296 / Number / 187 / 54 / 39 / 46 / 40
Genotype frequency / GG / 0.5989(112) / 0.7408(40) / 0.5641(22) / 0.8696(40) / 0.7250(29)
GC / 0.2995(56) / 0.2407(13) / 0.4359(17) / 0.1304(6) / 0.2500(10)
CC / 0.1016(19) / 0.0185(1) / 0.0(0) / 0.0(0) / 0.0250(1)
Allele
frequency / G / 0.7487 / 0.8611 / 0.7821 / 0.9348 / 0.8500
C / 0.2513 / 0.1389 / 0.2179 / 0.0652 / 0.1500
H-W test / χ2 / 7.80* / 0.0 / 0.02 / 3.03 / 0.22
454 / Number / 198 / 53 / 35 / 43 / 38
Genotype frequency / TT / 0.2071(41) / 0.1321(7) / 0.0857(3) / 0.7907(34) / 0.6579(25)
GT / 0.5000(99) / 0.3773(20) / 0.5714(20) / 0.1860(8) / 0.2632(10)
GG / 0.2929(58) / 0.4906(26) / 0.3429(12) / 0.0233(1) / 0.0789(3)
Allele frequency / T / 0.4571 / 0.3208 / 0.3714 / 0.8837 / 0.7895
G / 0.5429 / 0.6792 / 0.6286 / 0.1163 / 0.2105
H-W test / χ2 / 0.01 / 0.95 / 1.75 / 0.39 / 1.65
505 / Number / 181 / 50 / 44 / 45 / 39
Genotype frequency / TT / 0.5967(108) / 0.36(18) / 0.2045(9) / 0.8667(39) / 0.7948(31)
TA / 0.3481(63) / 0.52(26) / 0.7273(32) / 0.1111(5) / 0.1026(4)
AA / 0.0552(10) / 0.12(6) / 0.0682(3) / 0.0222(1) / 0.1026(4)
Allele
frequency / T / 0.7707 / 0.62 / 0.5682 / 0.9222 / 0.8462
A / 0.2293 / 0.38 / 0.4318 / 0.0778 / 0.1538
H-W test / χ2 / 0.04 / 0.54 / 10.23 ** / 2.29 / 14.33***
1960-
1977 / Number / 186 / 54 / 55 / 56 / 43
Genotype frequency / +/+ / 0.3925(73) / 0.2963(16) / 0.4545(25) / 0.5714(32) / 0.0698(3)
+/- / 0.4892(91) / 0.6481(35) / 0.5273(29) / 0.4107(23) / 0.9302(40)
-/- / 0.1183(22) / 0.0556(3) / 0.0182(1) / 0.0179(1) / 0.0(0)
Allele
frequency / + / 0.6371 / 0.6204 / 0.7182 / 0.7768 / 0.5349
- / 0.3629 / 0.3796 / 0.2818 / 0.2232 / 0.4651
H-W test / χ2 / 0.63 / 7.64 * / 5.04 / 1.90 / 32.51***
3433 / Number / 169 / 60 / 51 / 58 / 48
Genotype frequency / AA / 0.0592(10) / 0.0667(4) / 0.0(0) / 0.0(0) / 0.0208(1)
GA / 0.2899(49) / 0.5(30) / 0.5686(29) / 0.0345(2) / 0.1458(7)
GG / 0.6509(110) / 0.4333(26) / 0.4314(22) / 0.9655(56) / 0.8334(40)
Allele
frequency / A / 0.2041 / 0.3167 / 0.2843 / 0.0172 / 0.0938
G / 0.7959 / 0.6833 / 0.7157 / 0.9828 / 0.9062
H-W test / χ2 / 1.96 / 1.45 / 8.05 * / 0.02 / 0.96
3688 / Number / 176 / 48 / 50 / 60 / 43
Genotype frequency / CC / 0.6818(120) / 0.7084(34) / 0.78(39) / 0.9833(59) / 0.9767(42)
CA / 0.3011(53) / 0.2708(13) / 0.22(11) / 0.0167(1) / 0.0233(1)
AA / 0.0171(3) / 0.0208(1) / 0.0(0) / 0.0(0) / 0.0(0)
Allele
frequency / C / 0.8324 / 0.8438 / 0.89 / 0.9917 / 0.9884
A / 0.1676 / 0.1562 / 0.11 / 0.0083 / 0.0116
H-W test / χ2 / 1.10 / 0.04 / 0.76 / 0.0 / 0.01
The numbers in the brackets are the genotype individuals. * P<0.05, ** P<0.01, *** P<0.001
Table S3 Test of difference of 296/454/505 sites(above diagonal) and 1960-1977/3433/3688 sites (below diagonal) site genotype distributions of KiSS-1 in five goat breeds
Breed / Jining Grey goat / Liaoning Cashmere goat / Inner Mongolia Cashmere goat / Boer goat / Wendengdairy goat
Jining Grey goat / 5.33/7.44/9.40 / 5.89/2.86/22.62*** / 12.78*/57.00***/11.57* / 3.32/32.69***/9.47
Liaoning Cashmere goat / 4.64/9.23/0.19 / 4.46/3.21/4.25 / 2.96/45.52***/25.34*** / 0.06/11.12*/18.91***
Inner Mongolia Cashmere goat / 4.98/14.75**/2.29 / 3.53/3.64/1.47 / 9.98*/40.02***/39.45*** / 3.76/25.94***/33.84***
Boer
goat / 8.31/21.82***/22.21 *** / 8.78/39.45***/16.88** / 1.54/38.04***/11.60 * / 3.35/2.30/2.41
Wendeng
dairy goat / 27.92***/5.89/15.62 ** / 11.12*/17.96**/11.89 * / 18.85***/19.60***/7.96 / 28.30***/5.55/0.06
* P<0.05, ** P<0.01, *** P<0.001
Fig. S1 Amplification results of goat KiSS-1 gene (1.0% agarose stained with ethidium bromide), M: DL2000 DNA Marker (TaKaRa, Dalian, China). a, PCR product with primer KS1; b, PCR product with primer KS2; c, PCR product with primer KS3
Fig. S2 The CDS and amino acid homology trees. a, CDS homology tree. b, amino acid homology tree
Fig. S3a The prediction result of signal peptide and post-translation modification of goat KiSS-1 protein. The sequence underlined represents the signal peptide. S and T represent the predicted GalNAc O-glycosylation sites. The serine and threonine residues with triangle under the abbreviation letter represent the predicted phosphorylated serine and threonine residues
Fig. S3b Alignment of amino acid sequences of KiSS-1 peptides from different mammals. The sources of sequences are: human (GenBank: AY117143), rat (GenBank: NM181692), mouse (GenBank: NP839991.1), bovine (GenBank: XP872566.1) and goat (the present study). Metastin (under the line), kisspeptin-10 (underlined) amino acid sequences and LRY/LRF (in blue frame) are shown
Fig. S4 The hydropathy analysis of goat KiSS-1 protein. The lateral axis represents the position of amino acid residue and the longitudinal axis represents the protscale score, the positive value means hydrophobicity, the negative value means hydrophilicity.