Supplemental Figure S1

Supplemental Figure S1

Supplemental Figure S1. Seedling responses of 52 Arabidopsis accessions on spectinomycin. The numerical score used to designate the extent of seedling development (1, very limited; 6, extensive) was later modified to letters (A through J), as described in the Materials and Methods, to enable more accurate descriptions of segregating F2 populations. Tolerant accessions (green; Jl-3, Be-1, Tsu-0); sensitive accessions (red; “Nossen”, Oy-0, Nie1-2, Sav-0), and intermediate accessions (blue; Col-0, Ler-1) of special interest are highlighted.

Supplemental Figure S2

Supplemental Figure S2. Seedling responses of selected accessions on lincomycin. Lincomycin is an inhibitor of chloroplast translation witha ribosome binding site and mode of action different from that of spectinomycin. Clockwise from lower left: Tolerant, Jl-3, Be-1, Tsu-0; Sensitive, “Nossen”. Plate diameter,9 cm.

Supplemental Figure S3

Supplemental Figure S3. Expected F2 progeny from a selfed F1 plant heterozygous for an embryo-defective mutation (Ee) and a second locus conferring sensitivity (S) or tolerance (T) to a loss of chloroplast translation. Green (top left quadrant), wild-type (EE) seeds and plants; Yellow, heterozygous (Ee) seeds and plants; Red (lower right quadrant), aborted (ee) seeds that do not germinate.

Supplemental Figure S4

Allele / Organism / Allele Symbol / Mutation / Reference / Allele / Organism / Allele Symbol / Mutation / Reference
1 / A. thaliana / gsd1 / E 188 K / Lü et al. (2011) / 11 / D. melanogaster / Acc1 / Q 397 Stop / Sasamura et al. (2013)
2 / A. thaliana / gk-sc;
gk-U413 / Altered Splice
Site 233 / Baud et al. (2003);
Kajiwara et al. (2004) / 12 / D. melanogaster / Acc2 / N 456 I / Sasamura et al. (2013)
3 / A. thaliana / acc1-3 / G 333 D / Kajiwara et al. (2004) / 13 / C. elegans / ye60 / A 564 V / Rappleye et al. (2003)
4 / A. thaliana / sfr3 / E 406 K / Amid et al. (2012) / 14 / S. cerevisiae / acc1ts / F 668 S / Schneiter et al. (2000)
5 / A. thaliana / emb22 / W 565 Stop / Kajiwara et al. (2004) / 15 / S. cerevisiae / acc1K735R / K 813 R / Schneiter et al. (1996)
6 / A. thaliana / pas3-1 / E 1689 K / Baud et al. (2004) / 16 / C. elegans / ye162 / G 1623 E / Rappleye et al. (2003)
7 / A. thaliana / acc1-1 / Insertion 1854 / Baud et al. (2004) / 17 / D. melanogaster / AccB131 / Insertion / Parvy et al. (2012)
8 / A. thaliana / pas3-2 / G 1888 S / Baud et al. (2004) / 18 / S. cerevisiae / Acc1C-term / R 1878 Stop / Schneiter et al. (2000)
9 / A. thaliana / gk-101 / G 1968 E / Kajiwara et al. (2004) / 19 / S. cerevisiae / acc1cs / G 1889 A / Schneiter et al. (2000)
10 / A. thaliana / acc1-2 / Insertion 2208 / Baud et al. (2004) / 20 / C. elegans / ye180 / P 1890 C / Rappleye et al. (2003)

Supplemental Figure S4. Conserved amino acid residues in eukaryotic ACCases and mutations analyzed in model genetic organisms.

A, ACCase protein domains and conserved amino acid residues identified in a multi-kingdom alignment of 20 eukaryotic ACC1/ACC2 proteins. TP, Transit peptide; BC, Biotin carboxylase domain; BCCP, Biotin carboxyl carrier protein domain; CT- β, Carboxyltransferase, β-subunit domain; CT-α, Carboxyltransferase, α-subunit domain. Red lines, amino acid residues conserved in all 20 sequences aligned as described in the Methods section; Green lines, amino acid residues conserved among nine plant sequences included in the alignment. Numbers correspond to amino acid residues for ACC2 from Arabidopsis thaliana, Columbia accession. The biotin binding site (K813) within the BCCP domain is marked with a thin black line.

B, Mutation sites found among ACCase mutants analyzed in model genetic organisms. Numbers correspond to mutant alleles defined in the table. Arabidopsis mutants are shown above the black horizontal line; mutants from other model organisms are shown below. Conserved domains correspond to those defined above. Squares, Missense mutations; Circles, Nonsense mutations; Triangles, Insertion mutations; Ellipse, Splicing defect. Red symbol, lethal mutant alleles; Green symbol, viable mutant alleles; Blue symbol, Temperature-sensitive and cold-sensitive mutant alleles. Red and green vertical lines are defined above. Black vertical lines, amino acid residues not conserved in the alignment; Gray vertical lines, degree of amino acid conservation irrelevant (missense mutation not involved).

C, Detailsof mutant alleles presented in Supplemental Figure S4B above.

Supplemental Figure S5

Supplemental Figure S5. Chromosome locations of Arabidopsis genes encoding known components of the chloroplast protein import system and EMB genes encoding chloroplast ribosomal proteins. The duplicated ACC1-ACC2 gene cluster is located above the centromere on chromosome 1; EMB3126 is located at the bottom of chromosome 3; EMB3137 is near the top of chromosome 5. The following suffixes designate knockout phenotypes: se, single gene knockout is embryo defective; sp, single gene knockout has a pigment defect; de, double knockouts with a redundant gene are embryo defective; dp, double knockouts with a redundant gene have a pigment defect; dg, double knockouts with a redundant gene have a gametophyte defect; dep, double knockouts with a redundant gene exhibit either embryo or pigment defects; np, no phenotype detected in single gene knockout; nd, phenotype of knockout mutant not described.

Supplemental Figure S6

Supplemental Figure S6. DNA sequence polymorphisms used to genotype plants for ACC2, TOC34, EMB3137, andOEP80in Tsu-0 crosses withemb3126-1. Note that sequence profiles of heterozygotes differ from those of both parental accessions. Additional polymorphisms within the sequenced region were used when needed to confirm genotype assignments.

Supplemental Table S1. Natural accessions of Arabidopsis thaliana examined on spectinomycin.

ABRC Seed Stock / ABRC Parental Stock / Symbol / Full name / Country / Donor
CS28639 / CS6833 / Pi-2 / Pitzal / Austria / Kranz
CS28015 / CS6603 / An-1 / Antwerpen / Belgium / Kranz
CS28796 / CS6884 / Van-0 / Vancouver / Canada / Kranz
CS28197 / CS6675 / Cvi-0 / Cape Verde Islands / Cape Verde Islands / Kranz
CS28725 / CS6856 / Sav-0 / Slavice / Czech Republic / Kranz
CS28369 / CS6745 / Jl-3 / Jl-3 / Czech Republic / Kranz
CS28665 / CS6844 / Ra-0 / Randan / France / Kranz
CS28473 / CS6784 / Lm-2 / Le Mans / France / Kranz
CS28060 / CS6611 / Bch-4 / Buchen / Germany / Kranz
CS28056 / CS22633 / Bay-0 / Bayreuth / Germany / Bergelson et al.
CS28449 / CS22618 / Ler-1 / Landsberg erecta / Germany / Bergelson et al.
CS28331 / CS22617 / Gu-0 / Blueckingen / Germany / Bergelson et al.
CS28528 / CS6803 / Nd-0/1 / Niederzenz / Germany / Kranz
CS28063 / CS6614 / Be-1 / Bensheim / Germany / Kranz
CS28203 / CS6678 / Db-1 / Dombachtal / Germany / Kranz
CS28233 / CS6695 / En-1 / Enkheim / Germany / Kranz
CS28275 / CS6716 / Gd-1 / Gudow / Germany / Kranz
CS28282 / CS6721 / Go-0 / Goettingen / Germany / Kranz
CS28390 / CS6757 / Kl-1 / Koeln / Germany / Kranz
CS28474 / CS6785 / Lo-1 / Lorrach / Germany / Kranz
CS28506 / CS22636 / Mz-0 / Merzhausen / Germany / Bergelson et al.
CS76402 / Nie1-2 / Germany
CS28595 / CS6826 / Pa-2 / Palermo / Italy / Kranz
CS28724 / CS22456 / Sapporo-0 / Sapporo / Japan / Hanzawa
CS28780 / CS6874 / Tsu-0 / Tsu / Japan / Kranz
CS76394 / Yeg-1 / Kaukasus
CS28427 / CS22606 / Kz-1 / Kazakhstan / Kazakhstan / Bergelson et al.
CS28502 / CS6799 / Mt-0 / Martuba/Cyrenaika / Libya / Kranz
CS28395 / CS6762 / Kn-0 / Kaunas / Lithuania / Kranz
CS28346 / CS6736 / Hi-0 / Hilversum / Netherlands / Kranz
CS28578 / CS22661 / Nz-1 / New Zealand / New Zealand / Campanella
CS76417 / Qui-0 / North Africa / Spain
CS28591 / CS6824 / Oy-0 / Oystese / Norway / Kranz
CS28493 / CS6793 / Mh-1 / Muhlen / Poland / Kranz
CS28250 / CS22645 / Fei-0 / St. Maria d. Feiria / Portugal / Bergelson et al.
CS28688 / CS6927 / RLD-2 / RLD / Russia / Holub
CS28243 / CS6700 / Est-0/1 / Estland / Russia / Kranz
CS28819 / CS6888 / Wil-1 / Wilna / Russia / Kranz
CS28828 / CS22659 / Ws-2 / Wassilewskija / Russia / Bergelson et al.
CS28086 / CS6624 / Bla-1/12 / Blanes / Spain / Kranz
CS28240 / CS22548 / Eri-1 / Eriengsboda / Sweden / Koornneef
CS28816 / CS22622 / Wei-0 / Weiningen / Switzerland / Bergelson et al.
CS28847 / CS6903 / Zu-1 / Zurich / Switzerland / Kranz
CS28736 / CS22652 / Sha / Shakdara / Tadjikistan / Bergelson et al.
CS76382 / Sha / Shakdara / Tadjikistan
CS28230 / CS920 / En-D / Enkheim / Ukraine / Vizir
CS28532 / CS22598 / Nfa-8 / Nfa-8 / United Kingdom / Bergelson et al.
CS28067 / CS8068 / Berkeley / Berkeley / USA / Murphy
CS28355 / CS22597 / HR-10 / Harvard Square / USA / Bergelson
CS28127 / CS22620 / C24 / C24 / Not Specified / Bergelson et al.
Lab / Redei / Col-0 / Columbia / Uncertain / Meinke
Lab / Riken / "Nos" / "Nossen" / Uncertain / Shinozaki

Supplemental Table S2. Seedling responses on spectinomycin of parental accessions and F2 progeny

from crosses between accessions.

Genotype Examined / Seeds Plated / Seedlings Assigned to Each Phenotype Class (%)a
Sensitive / Intermediate / Tolerant
A / B / C / D / E / F / G / H / I / J
"Nossen" / 178 / 41 / 24 / 30 / 3 / 2 / - / - / - / - / -
Tsu-0 / 133 / - / - / - / - / - / 4 / 76 / 20 / - / -
Tsu-0 x "Nossen" / 233 / 23 / 1 / 7 / 15 / 3 / 23 / 19 / 9 / - / -
Be-1 / 131 / - / - / - / - / - / 2 / 45 / 51 / 2 / -
Be-1 x "Nossen" / 140 / 15 / 13 / 6 / 18 / 3 / 23 / 14 / 5 / 3 / -
Jl-3 / 135 / - / - / - / - / 1 / 7 / 25 / 48 / 17 / 2
Jl-3 x "Nossen" / 198 / 24 / 8 / 5 / 10 / 12 / 17 / 12 / 11 / 1 / -
a Letters define classes from expanded cotyledons without leaves (A) to extensive rosettes with sizeable leaves (I,J) as defined in Materials and Methods.

Supplemental Table S3. Phenotypes and genetic backgrounds (accessions) of embryo-defective mutants of Arabidopsis disrupted in chloroplast

translation.

Accession / Mutant Allele / Insertion Line # / Embryo Phenotype / Locus / Role in Chloroplast Translation / Additional Notes / Referencesa
"Nossen" / emb3126-1 / Riken 53-3245-1 / Preglobular / At3g63490 / Ribosomal protein L1 / Bryant et al. (2011)
"Nossen" / emb3137-1 / Riken 15-0663-1 / Preglobular / At5g14320 / Ribosomal protein S13 / Bryant et al. (2011)
"Nossen" / emb3136 / Riken 51-2522-3 / Preglobular / At5g13510 / Ribosomal protein L10 / Bryant et al. (2011)
"Nossen" / emb3113-1 / Riken 11-2624-1 / Preglobular / At2g33800 / Ribosomal protein S5 / Bryant et al. (2011)
"Nossen" / emb3105 / Riken 52-0944-1 / Preglobular / At1g48350 / Ribosomal protein L18 / Bryant et al. (2011)
"Nossen" / emb2394-2 / Riken 54-1238-1 / Preglobular / At1g05190 / Ribosomal protein L6 / Bryant et al. (2011)
Columbia / emb3137-2 / Salk 133412 / Large globular / At5g14320 / Ribosomal protein S13 / Bryant et al. (2011)
Columbia / emb2784 / Salk 094226 / Large globular / At1g07320 / Ribosomal protein L4 /
Columbia / prpl 1-1 / SAIL 295_A02 / Large globular / At3g63490 / Ribosomal protein L1 / Romani et al. (2012)
Columbia / prpl27-1 / GABI 123H12 / Large globular / At5g40950 / Ribosomal protein L27 / Romani et al. (2012)
Columbia / prpl35-1 / SAIL 367_E07 / Large globular / At2g24090 / Ribosomal protein L35 / Romani et al. (2012)
Columbia / prpl4-1 / Salk 117563 / Large globular / At1g07320 / Ribosomal protein L4 / Romani et al. (2012)
Columbia / prps20-1 / Salk 094710 / Large globular / At3g15190 / Ribosomal protein S20 / Romani et al. (2012)
Columbia / asd-2 / Salk 090292 / Large globular / At1g35680 / Ribosomal protein L21 / Yin et al. (2012)
Columbia / asd-3 / Salk 096866 / Large globular / At1g35680 / Ribosomal protein L21 / Yin et al. (2012)
Columbia / asd-1 / Point mutation / Large globular / At1g35680 / Ribosomal protein L21 / Point mutation in T-DNA insertion line / Yin et al. (2012)
Columbia / emb1473 / Syngenta 24154 / Large globular / At1g78630 / Ribosomal protein L13 /
Columbia / sco1-2 / Salk 046154 / Large globular / At1g62750 / Translation elongation factor G / Ruppel and Hangarter (2007)
Columbia / sco1-3 / Salk 039084 / Large globular / At1g62750 / Translation elongation factor G / Ruppel and Hangarter (2007)
Columbia / emb2726-1 / Syngenta 129824 / Large globular / At4g29060 / Translation elongation factor Ts /
Columbia / emb2247-1 / Syngenta 73553 / Large globular / At5g16715 / Valyl-tRNA synthetase / Berg et al. (2005)
Columbia / emb2247-2 / Syngenta 67816 / Large globular / At5g16715 / Valyl-tRNA synthetase / Berg et al. (2005)
Columbia / emb1027 / Syngenta 1917 / Large globular / At4g26300 / Arginyl-tRNA synthetase / Berg et al. (2005)
Columbia / emb2369-1 / Syngenta 81281 / Large globular / At4g04350 / Leucyl-tRNA synthetase / Berg et al. (2005)
Columbia / edd-1S / Syngenta 56882 / Large globular / At3g48110 / Glycyl-tRNA synthetase /
Columbia / emb2394-1 / Syngenta 82754 / Large globular;
Some later stages / At1g05190 / Ribosomal protein L6 / Possible weak allele /
Columbia / emb2184 / Syngenta 60944 / Transition / At1g75350 / Ribosomal protein L31 / Possible less essential protein /
Columbia / twn3 / Syngenta 75709 / Cotyledon / At1g74970 / Ribosomal protein S9 / Presumed weak allele or less essential protein /
Columbia / emb3113-2 / Salk 095863 / Pigment defective embryo / At2g33800 / Ribosomal protein S5 / Presumed weak allele /
Ler / emb3126-2 / CSHL GT6376 / Small globular / At3g63490 / Ribosomal protein L1 / Bryant et al. (2011)
Ler / emb3126-3 / JIC GT 5 101962 / Small globular / At3g63490 / Ribosomal protein L1 / Bryant et al. (2011)
WS / emb2369-2 / Genoplante EVM17 / Large globular / At4g04350 / Leucyl-tRNA synthetase / WS similar to Columbia /
C24 / edd-1 / Not specified / Transition / At3g48110 / Glycyl-tRNA synthetase / C24 may extend development / Uwer et al. (1998)
a Included in the Literature Cited section of the text. See also Savage et al. (2013);

Supplemental Table S4. Reduced embryo development in F1 siliques from acc2 (Columbia) crosses with emb3137-2

(Columbia).

Cross / F2
Seeds Screened / Percent Mutant Seeds / Mutant Seeds Screened / Percent Preglobular Embryos / Average Seed Size (μm) / Parental Embryo Lengths (μm) / Parental Embryo Stages (%)
Preglobular / Parental / Average / Minimum / Maximum / Globular / Triangular
1 / 466 / 27.7 / 129 / 22.5 / 400 / 564 / 89 / 70 / 130 / 90.3 / 9.7
2 / 173 / 32.9 / 57 / 33.3 / 418 / 605 / 92 / 60 / 120 / 97.1 / 2.9
Total / 639 / 29.1 / 186 / 25.8 / 407 / 575 / 90 / 60 / 130 / 92.2 / 7.8
WT / 1321 / 0.2 / - / - / - / - / - / - / - / - / -
a Two classes of mutant seeds are found in F1 siliques: preglobular seeds presumed to be acc2 homozygotes,and large seeds with globular embryos (acc2/ACC2;ACC2/ACC2) characteristic of parental emb3137-2 lines.

Supplemental Table S5. ACC2 gene disruptions identified in natural accessions of Arabidopsisa.

Accession / ACC2
Mutation / ABRC
Stock / Seedling
Response on
Spectinomycin
"Nossen" / R 865 Stop / Riken / Sensitive
Kb_0 / Y 753 Stop / CS76524 / Sensitive
Kl_5 / Y 753 Stop / CS76528 / Sensitive
Blh-1-1 / K 1225 Stop / CS28089 / Sensitive
Hod / Q 2325 Stop / CS76924 / Intermediateb
Ob-0 / C-Terminal Deletion
or Rearrangement / CS76566 / Sensitive
Old-1 / C-Terminal Deletion
or Rearrangement / CS76567 / Sensitive
a Confirmed in our laboratory through PCR amplification and DNA sequencing.
b The nonsense mutation in this accession is close to the end of the coding region.

Supplemental Table S6. Modifier phenotype classes of late TT plants from a Tsu-0 cross with emb3126-1.

Plants Analyzed / Mutant Embryos Analyzed / Embryo Lengths (%) / Embryo Phenotypes (%)
Modifier
Class / Plant Generation / Number Screened / Number Measured / Avg. Length
(µm) / < 100 μm / > 200 μm / > 300 μm / Globular / Triangular / Linear / Cotyledon
Late;
Advanceda / F3 / 4 / 245 / 256 / 0.0 / 61.5 / 30.1 / 0.0 / 10.5 / 45.8 / 43.9
Late;
Moderatea / F3 / 12 / 474 / 184 / 0.6 / 25.9 / 6.1 / 5.4 / 20.2 / 55.2 / 19.2
Late;
Reduceda / F3 / 8 / 435 / 146 / 3.4 / 6.6 / 1.0 / 14.7 / 38.8 / 41.0 / 5.5
Late; Advanced; Lateb / F4 / 3 / 134 / 345 / 0.0 / 94.5 / 60.9 / 0.0 / 0.0 / 29.3 / 70.7
Late; Advanced; Moderateb / F4 / 11 / 569 / 254 / 0.0 / 64.7 / 28.3 / 0.0 / 4.3 / 52.9 / 42.8
a Progeny plants from the "late" class of F2 plants homozygous Tsu-0 for the suppressor and enhancer.
b Progeny plants from the "late; advanced" class of F3 plants homozygous Tsu-0 for the suppressor and enhancer.

Supplemental Table S7. Differences in the extent of embryo rescue in TT plants from Tsu-0 crosses with

emb3137-1 and emb3126-1.

Mutant
Allele / F2 Plants Screened / Mutant Seeds Screened / Embryo Lengths
(μm) / Embryos Measured
(%) / Embryo Phenotypes
(%)
Average / Maximum / < 100 μm / > 100 μm / Globular / Triangular / Linear / Cotyledon
emb3137-1 / 20 / 531 / 77 / 130 / 82.7 / 6.4 / 96.2 / 3.8 / 0.0 / 0.0
emb3126-1 / 31 / 965 / 99 / 500 / 60.9 / 31.6 / 68.2 / 17.5 / 11.1 / 3.2

Supplemental Table S8. Partial embryo rescue in F1 siliques from a Tsu-0 cross with emb1473 (Columbia).

Cross / F2
Seeds Screened / Percent Mutant Seeds / Mutant Seeds Screened / Embryos Measured
(%) / Embryo Lengths
(μm) / Embryo Stages
(%)
> 100 μm / > 150 μm / Average / Minimum / Maximum / Globular / Triangular / Linear / Cotyledon
1 / 440 / 24.1 / 106 / 36.8 / 23.6 / 128 / 60 / 470 / 62.2 / 14.2 / 11.3 / 12.3
2 / 711 / 21.7 / 154 / 37.0 / 21.4 / 117 / 60 / 400 / 63.0 / 16.2 / 14.3 / 6.5
Total / 1151 / 22.6 / 260 / 36.9 / 22.3 / 122 / 60 / 470 / 62.7 / 15.4 / 13.1 / 8.8
a Results are similar to emb3126 (both genes are unlinked to the enhancer). Note the presence of large embryos beyond the globular stage.

Supplemental Table S9. Limited embryo rescue in F1 siliques from a Tsu-0 cross with emb3136 (“Nossen”).

Cross / F2
Seeds Screened / Percent Mutant Seeds / Mutant Seeds Screened / Percent Preglobular Embryos / Average Seed Size
(μm) / Rescued Embryo Lengths
(μm) / Rescued Embryo Stages (%)
Preglobular / Rescued / Average / Minimum / Maximum / Globular / Triangular
1 / 988 / 25.8 / 255 / 20.0 / 370 / 522 / 65 / 50 / 110 / 98.5 / 1.5
2 / 562 / 22.2 / 125 / 20.0 / 382 / 521 / 69 / 50 / 110 / 99.0 / 1.0
Total / 1550 / 24.5 / 380 / 20.0 / 374 / 521 / 66 / 50 / 110 / 98.7 / 1.3
a Results are similar to emb3137 (both genes are linked to the enhancer). Note the absence of large embryos beyond the triangular stage.

Supplemental Table S10. PCR primer sequences used for RT-qPCR and plant genotyping.

Primer Name / Primer Sequence / Purpose / Primer Location and Direction / PCR
Product / PCR Parameters
Genotyping Accessions
ACC2-Tsu-F / CAATAAGCTTCTATTATAAGCTTCTA / PCR Genotype ACC2;
Tsu-0 Specific / 907 bp after ACC2 stop codon / 350 bp / 95°C for 3 min, then 35 cycles of 95°C for 1 min, 58°C for 1 min, 72°C for 1 min, and final cycle at 72°C for 10 min.
ACC2-Tsu-R / TCATTTAATTGGTTTGCTTTAGGT / 1257 bp after ACC2 stop codon
ACC2-No-F / CTACTCGATTACATATTTTGCATTT / PCR Genotype ACC2;
"Nossen" Specific / 394 bp after ACC2 stop codon / 510 bp / 95°C for 3 min, then 31 cycles of 95°C for 1 min, 61°C for 1 min, 72°C for 1 min, and final cycle at 72°C for 10 min.
ACC2-No-R / AAGAGGTTTTTAATAAAAGCTTATTGT / 904 bp after ACC2 stop codon
TOC34-seq-F / TTCGTCGTAGCCTTAACAAGAC / Sequence Genotype TOC34;
Multiple Accessions / 979 bp after TOC34 stop codon / 1498 bp / 95°C for 3 min, then 35 cycles of 95°C for 1 min, 62°C for 1 min, 72°C for 2 min, and final cycle at 72°C for 10 min.
TOC34-seq-R / CAGCGGAAGATGCCATAAGA / TOC34 5th exon, 1014 bp from start codon
EMB3137-seq-F / ACTCCAGTTGAGACTGTTCTTG / Sequence Genotype EMB3137;
Multiple Accessions / 3693 bp after EMB3137 stop codon / 502 bp
EMB3137-seq-R / GGTCGCTCATGGTGAACTT / 3191 bp after EMB3137 stop codon
OEP80-seq-F / CCATCATCAGCTACCGTCAAT / Sequence Genotype OEP80;
Multiple Accessions / 1052 bp from OEP80 start codon / 952 bp
OEP80-seq-R / ATTCGGAGACTCGGAGTAGAA / 100 bp from OEP80 start codon
ACC2-seq-F / AAGAGAGCACTTGGAACACTAC / Sequence Genotype ACC2;
Multiple Accessions / 447 bp after ACC2 stop codon / 725 bp
ACC2-seq-R / AGCTTTAGACCATCCTCAATGG / 1172 bp after ACC2 stop codon
Genotyping T-DNA Insertion Lines
toc34-1-F / ATTGGTCCAACTACTACAAGACG / Genotype SALK_059206;
Gene-specific primer pair / Refer to TAIR and Salk Insertion Site Database / 1446 bp
WT / 95°C for 3 min, then 35 cycles of 95°C for 1 min, 56°C for 1 min, 72°C for 2 min, and final cycle at 72°C for 10 min.
toc34-1-R / GCGCCATGTTCGTTTCTAAAG
acc2-2-F / ACGGCAATCTCCGGTAAAG / Genotype SALK_110264;
Gene-specific primer pair / Refer to TAIR and Salk Insertion Site Database / 931 bp
WT / 95°C for 3 min, then 35 cycles of 95°C for 1 min, 62°C for 1 min, 72°C for 1 min, and final cycle at 72°C for 10 min.
acc2-2-R / CCTGGTGTGCGAAGGATAAT
acc2-1-F / CACCAGCTTAGGTCTTGTAGTG / Genotype SALK_148966;
Gene-specific primer pair / Refer to TAIR and Salk Insertion Site Database / 718 bp
WT
acc2-1-R / CTATCTGCTGCTCACGTAGTATG
LBa1 / TGGTTCACGTAGTGGGCCATCG / Salk T-DNA left border primer / Refer to TAIR and Salk Insertion Site Database / Yes
Mutant
RT-qPCR: ACC2 Expression in Different Accessions
18S rRNA RT-F / CTGCGAAAGCATTTGCCAAGGATG / Reference housekeeping gene 18S rRNA - high expression / Both primers are located in the only exon / 90 bp / Standard conditions for Roche SYBR Green PCR kit
18S rRNA RT-R / TGGTTGAGACTAGGACGGTATCTG
ACT2 RT-R / AGCCTTTGATCTTGAGAGCTTAGA / Reference housekeeping gene ACTIN2 - medium expression / Flanking last intron / 95 bp / Standard conditions for Roche SYBR Green PCR kit
ACT2 RT-F / ATTCCAGCAGATGTGGATCTCCAA / Located in last exon
ACC2 RT-F / TTCTAAACAAGGTGGATCTTTCAAGAAG / RT-qPCR for ACC2 / Flanking last intron / 85 bp / Standard conditions for Roche SYBR Green PCR kit
ACC2 RT-R / AACCTCATATAGATATATCAACCCAACACC / Located in last exon
ACC1 RT-F / TCTTCTAAACAAGGTGGAGCCGTC / RT-qPCR for ACC1 / Flanking last intron / 79 bp / Standard conditions for Roche SYBR Green PCR kit
ACC1 RT-R / CTTCGATATCAGTCAACCCAAGACC / Located in last exon
ACC2 Genomic Sequencing from "Nossen" Plants
ACC2-F1 / ATCCGATCTCCTTCTTGGATAATG / PCR amplify ACC2 fragment, N-terminus / Located in 1st exon / 6.7Kb / Standard conditions for Takara PrimeSTAR DNA Polymerase Kit
ACC2-R8 / GAAATGGGAGTTCAGGGCTATC / Located in 20th exon
ACC2-F8 / CTCTACGTGATGGAGGTCTATTG / PCR amplify ACC2 fragment, C-terminus / Located in 16th exon / 7.4Kb / Standard conditions for Takara PrimeSTAR DNA Polymerase Kit
ACC2-R16 / AGCTTTAGACCATCCTCAATGG / Located 1.1 Kb after stop codon

Supplemental Table S11. Sequences used for ACC1/ACC2 alignments and determination of Ka/Ks ratios.

Species / Purpose / Sequences Analyzed / Relevant Website / Additional Citations
Arabidopsis thaliana / Multi-Kingdom
Alignment; Ka/Ks / ACC1 (NP_174849.2; At1g36160)
ACC2 (NP_174850.4; At1g36180) / NCBI (
TAIR 10 (
Brassica rapa Chiifu-401 / Multi-Kingdom
Alignment; Ka/Ks / ACC1 (Bra036771)a
ACC2 (Bra018702) / Phytozome v9 (
Brassica Database ( / Cheng et al. (2011)
Medicago truncatula / Multi-Kingdom
Alignment / ACC (XP_03638794.1) / NCBI (
Triticum aestivum / Multi-Kingdom
Alignment / Cytosolic ACC (ACD46686.1)
Plastid ACC (ACD46683.1) / NCBI (
Zea mays / Multi-Kingdom
Alignment / Cytosolic ACC; hypothetical (AFW68888.1)b
Plastid ACC (AAA80214.1) / NCBI (
Homo sapiens / Multi-Kingdom
Alignment / ACC1 (Isoform 1) (NP_942131.1)
ACC2 (Precursor) (NP_001084.3) / NCBI (
Mus musculus / Multi-Kingdom
Alignment / ACC1 (NP_579938.2)
ACC Beta Precursor (NP_598665.2) / NCBI (
Danio rerio / Multi-Kingdom
Alignment / ACC Alpha (NP_001258237.1)
ACC2 Isoform X1 (XP_005165251.1) / NCBI (
Drosophila melanogaster / Multi-Kingdom
Alignment / ACC Isoform A (AAF59155.2)c / NCBI (
Saccharomyces cerevisiae / Multi-Kingdom
Alignment / ACC1 (NP_014413.1)
ACC HFA1 (NP_013934.1)d / NCBI (
Schizosaccharomyces pombe / Multi-Kingdom
Alignment / Acetyl CoA/Biotin Carboxylase
(NP_593271.1) / NCBI (
Neurospora crassa / Multi-Kingdom
Alignment / ACC (XP_963017.1) / NCBI (
Arabidopsis lyrata / Ka/Ks / ACC1 (922767)
ACC2 (473714) / Phytozome v10
( / Hu et al. (2011)
Capsella rubella / Ka/Ks / ACC1 (Carubv10011872m)
ACC2 (Carubv10008063m) / Phytozome v10
( / Slotte et al. (2013)
Leavenworthia alabamica / Ka/Ks / Obtained from Genome Sequence / CoGe ( / Lyons et al. (2008)
Sisymbrium irio / Ka/Ks / Obtained from Genome Sequence / CoGe ( / Lyons et al. (2008)
Boechera stricta / Absence
of ACC2 / ACC1 (Bostr.20910s0015.1) / Phytozome v10
( / Boechera stricta v1.2, DOE-JGI
Aethionema arabicum / Absence
of ACC2 / Obtained from Genome Sequence / CoGe ( / Lyons et al. (2008)
Brassica rapa FPsc / ACC1/ACC2
Organization / ACC1 (Brara.H00605.1)
ACC2 (Brara.F00455.1) / Phytozome v10
( / Brassica rapa FPsc v1.3, DOE-JGI
Eutrema parvulum / ACC1/ACC2
Organization / ACC1 (Tp1g30640)
ACC2 (Tp1g30680) / CoGe ( / Lyons et al. (2008)
Theobroma cacao / Ka/Ks;
Brassicaceae
Close Relative / ACC (Thecc1EG034957t1) / Phytozome v10
( / Motamayor et al. (2013)
a Genomic sequence for ACC1 (Phytozome v9) was used to add conserved amino acids missing from the predicted protein.
b Genomic sequence for cytosolic ACC (NCBI) was used to add conserved amino acids missing from the predicted protein.
c Isoform A chosen because all other isoforms are contained within.
d Genomic sequence for ACC HFA1 (Saccharomyces Genome Database) was used to add conserved, N-terminal amino acids missing from the predicted protein.

Literature Cited – Supplemental Figures and Tables

Amid A, Lytovchenko A, Fernie AR, Warren G, Thorlby GJ (2012) The sensitive to freezing3 mutation of Arabidopsis thaliana is a cold-sensitive allele of homomeric acetyl-CoA carboxylase that results in cold-induced cuticle deficiencies. J Exp Bot 63: 5289-5299

Baud S, Guyon V, Kronenberger J, Wuillème S, Miquel M, Caboche M, Lepiniec L, Rochat C (2003) Multifunctional acetyl-CoA carboxylase 1 is essential for very long chain fatty acid elongation and embryo development in Arabidopsis. Plant J 33: 75-86

Baud S, Bellec Y, Miquel M, Bellini C, Caboche M, Lepiniec L, Faure JD, Rochat C (2004) gurke and pasticcino3 mutants affected in embryo development are impaired in acetyl-CoA carboxylase. EMBO Rep 5: 515-520

Berg M, Rogers R, Muralla R, Meinke D (2005) Requirement of aminoacyl-tRNA synthetases for gametogenesis and embryo development in Arabidopsis. Plant J 44: 866-878

Bryant N, Lloyd J, Sweeney C, Myouga F, Meinke D (2011) Identification of nuclear genes encoding chloroplast-localized proteins required for embryo development in Arabidopsis. Plant Physiol 155: 1678-1689

Cheng F, Liu S, Wu J, Fang L, Sun S, Liu B, Li P, Hua W, Wang X (2011) BRAD, the genetics and genomics database for Brassica plants. BMC Plant Biol 11: 136