SUPPLEMENTAL INFORMATION
Analysis of gene expression
Total RNA was extracted using the RNeasy mini kit (Qiagen, Hilden, Germany). RNA (1 g) was reverse transcribed into cDNA by using SuperScript II RT with oligo(dT) as primers (Invitrogen, Grand Island, NY) according to the manufacturer’s protocol. The following primers were used for amplification of specific cDNAs: human BCRP1: forward CCAGTTCCATGGCACTGGCCATA, reverse:CAGGGCCACATGATTCTTCCACA; human CC-10: forwardtcc gct tct gca gag atc t, reversecac agt gag ctt tgg gct; humanSP-C:forward gca acg cct ggc cct ga, reverse tgg cct gca gag agc att;humanOct3/4: forward TGGAGAAGGAGAAGCTGGAGCAAAA, reverse GGCAGATGGTCGTTTGGCTGAATA;humanNanog:forwardGCTGAGATGCCTCACACGGAG, reverse TCTGTTTCTTGACTGGGACCTTGTC; human 2-microglobulin: forward GGGTTTCATCCATCCGACAT, reverse GATGCTGCTTACATGTCTCGA; Human- mouse-actin: forwardTCGTCGACAACGGCTCCGGCATGT, reverse CCAGCCAGGTC CAGACGCAGGAT; mouse CD133: forwardtctgttcagcatttcctcac, reversetcagtatcgagacgggtc.
Mouse lung injury model
For mouse lung injury, naphthalene was dissolved in corn oil (Aldrich) and intraperitoneally administered (275mg/Kg) to nude or CD1 mice. Mice were sacrificed after 1 week, lungs were removed and enzymatically dissociated. Red cells were removed by hypotonic cell lysis. Lung cells obtained both from control or treated mice were subjected to control or anti-CD133 immunostaining using a mouse-specific PE-conjugated anti-CD133 antibody (clone 13A4, eBioscience, San Diego, CA). An aliquot of the same cell populations was used for RT-PCR analysis of CD133 expression, as described above. DNA amplification products were visualized with Typhoon (Amersham) and agarose gel bands quantification was performed with Imagequant software.
Legends to supplemental figures
Supplemental Figure1.CD133 expression levels in lungs of control or naphtalene-treated mice.
A) Flow cytometry analysis of control or naphthalene-treated mice derived cells. Percentage of CD133 positive cell fraction is indicated. B top) RT-PCR analysis of mouse -actin and CD133, performed on pulmonary cells obtained from control (C) or naphthalene-treated (N) mice. Neg is the PCR negative control. B bottom) Quantification of the increase of CD133 RNA levels in treated versus control mice. Agarose bands were quantified and normalized versus -actin levels.
Supplemental Figure2. Lung cancer spheres express pulmonary stem cell and embryonic markers.
RT-PCR analysis ofBCRP1(A) CC-10 (B),SP-C (B and C), Oct3/4 and Nanog (D) levels in the indicated four lung cancer subtype-derived tumorigenic cells(Spheres, S) or differentiated cells (D). Positive and negative control cells are MCF7 and K562 (A), fresh lung tumor cells and MCF7 for CC-10 (B), SKOV and A375 (D), respectivelyEqual amounts of cDNA for each sample was used based on control2-microglobulin PCR.