Genomic Stability Maintenance Pathway in Leptospira Spp
Table S1- List of organisms and the corresponding sequences used as seed to perform the similarity searches. The corresponding Gene ID numbers are presented.
Escherichia coli str. K-12 substr. MG1655 / Bacillussubtilissubsp. subtilisstr. 168 / Bacilluscereus ATCC 10987 / Mycobacterium tuberculosis H37Rv / Caulobactercrescentus CB15Directrepair
photolyase / 947005
SplB / 939248
ada / 946710
alkB / 946708
alt
aidB / 948710
BER
DNA glycomonofunction
alkA / 947371
alkC / 4584144
alkD / 4584089
MutY / 947447
tag / 947137
ung / 947067
MutT-Nudixmotif / 944824
bifunctional DNA glycosylase
endonuclease VIII (nei) / 945320
MutM (fpg) / 946765
endonuclease III (nth) / 947122
AP endonuclease
endonuclease IV (nfo) / 946669
endonuclease V (nfi) / 948502
exonuclease III (xth) / 946254
NER
uvrA / 948559
uvrB / 945385
uvrC / 947203
uvrD / 948347
mfd / 945681
pcrA / 938747 / 885442
repA / 2716946
MMR
dam / 947893
mutH / 947299
mutL / 948691
mutS / 947206
HHR
RecA / 947170
RecB / 947286
RecC / 947294
RecD / 947287
RecF / 948209
RecG / 948162
RecJ / 947367
RecO / 947038
RecR / 945100
RecQ / 948318 / 939671
RecS / 938969
RuvA / 946369
RuvB / 946371
RuvC / 946378
ssb / 948570
RecX / 947172
addA / 939793
AddB / 936341
SMC
Mre11 / 945049
Rad50 / 949076
RecN / 947105
NHEJ
Ku / 939375 / 885050
ATP dependentligase / 939372 / 885561
TLS
DNA pol II / 944779
DNA pol IV / 944922
DNA pol V/umuC / 946359
DNA pol V/umuD / 945746
imuA / 943830
imuB / 940967
dnaEII / 940962
Table S2 –Abbreviation of species names investigated in the phylogenetic analysis. The organisms are listed in alphabetic order within the taxa.
Organisms / Abbreviation / Division / AcessioncodeCenarchaeumsymbiosum / CENARSY / Archaea/ incertaesedis
Haladaptatuspaucihalophilus / HALADA / Archaea/Halobacteria* / gi|322368774
Halalkalicoccusjeotgali / HALAL / Archaea/Halobacteria* / gi|300711140
Haloferaxvolcanii / HALOFE / Archaea/Halobacteria* / gi|292656929
Methanococcusmaripaludis S2 / MARIPA / Archaea/ Euryarchaeota
Methanosarcinabarkeri fusaro_1 / MEBAR / Archaea/ Methanomicrobia
Methanosarcinamazei Go1 / MAZEI / Archaea/Methanomicrobia
Methanothermobacterthermautotrophicus str. Delta H / METHE / Archaea/Methanomicrobia
Nitrosopumilusmaritimus / NITROMA / Archaea/ incertaesedis
Picrophilustorridus / PICRO / Archaea/ Thermoplasmata
Pyrobaculumaerophilum / PYROPHI / Archaea/ Thermoprotei
Chlamydophilapneumoniae / CHLAMY / Chlamydiae
Deinococcusgeothermalis / DEIGEO / Deinococcus-Themus* / gi|94984215
Deinococcusmaricopensis / DEIMA / Deinococcus-Thermus* / gi|320335587
Deinococcusproteolyticus / DEIPRO / Deinococcus-Thermus* / gi|325284136
Deinococcusradiodurans R1 / DEIRA / Deinococcus-Thermus
Thermusthermophilus / THETHE / Deinococcus-Thermus
Leptospirillumrubarum / RUBARU / Nitrospira
Planctomycesmaris / PLAMA / Planctomycetes
Thermobaculumterrenum / BACULU / Thermobaculum
Chitinophagapinensis / CHITINO / Bacteroidetes/Sphingobacteria
Flavobacteriumbranchiophilum / FLABRAN / Bacteroidetes/Flavobacteria* / gi|347535508
Flavobacteriumjohnsoniae / FLAJO / Bacteroidetes/Flavobacteria* / gi|146299237
Mucilaginibacterpaludis / MUCIPA / Bacteroidetes/ Sphingobacteria* / gi|371989056
Niabella soli / NIABE / Bacteroidetes/Sphingobacteria * / gi|374372927
Niastellakoreensis / NIATE / Bacteroidetes/Sphingobacteria
Pedobactersp. / PEDOBA / Bacteroidetes/Sphingobacteria* / gi|149278419
Chloroflexusaggregans / AGGRE / Chloroflexi* / gi|219850496
Chloroflexusaurantiacus / AURAN / Chloroflexi* / gi|163845842
Sphaerobacterthermophilus / SPHAERO / Chloroflexi
Cyanothece / CYANO / Cyanobacteria* / gi|172037923
Microcoleuschthonoplastes / MICROCO / Cyanobacteria* / gi|254417495
Nostoc punctiforme PCC 73102 / NOSTOC / Cyanobacteria
Oscillatoria / OSCILLA / Cyanobacteria* / gi|300866658
Synechococcussp. WH 8102 / SYNECHO / Cyanobacteria
Synechocystissp. PCC 6803 / SYNECY / Cyanobacteria
Akkermansiamuciniphila ATCC BAA-835 / AKKER / Verrucomicrobia
Methylacidiphiluminfernorum / MEFER / Verrucomicrobia
Acholeplasmalaidlawii / ACHOLE / Firmicutes/Mollicutes
Acidaminococcusfermentans / ACIDA / Firmicutes/Negativicutes
Alkaliphilusmetalliredigens / ALKAME / Firmicutes/Clostridia
Bacilluscereus ATCC 10987 / BACERE / Firmicutes/Bacilli
Bacillussubtilis / BACSU / Firmicutes/Bacilli
Caloramatoraustralicus / CALORA / Firmicutes/Clostridia
Clostridium carboxidivorans / CLOSCA / Firmicutes/Clostridia* / gi|255527407
Clostridium hathewayi / CLOSHA / Firmicutes/Clostridia* / gi|358065198
Desulfitobacteriumdichloroeliminans / DESULDI / Firmicutes/Clostridia* / gi|374383563
Desulfitobacteriummetallireducens / DESULME / Firmicutes/Clostrida* / gi|354559127
Desulfosporosinusorientis / DESORI / Firmicutes/Clostridia* / gi|374993782
Lactobacillusjohnsonii / LACJO / Firmicutes/Bacilli
Listeriamonocytogenes / LISTERIA / Firmicutes/Bacilli
Staphylococcus aureus / STAPAU / Firmicutes/Bacilli
Thermosediminibacteroceani / SEDIMI / Firmicutes/Clostridia
Gemmatimonasaurantiaca / GEMMA / Gemmatimonadetes
Borreliaburgdorferi B31 / BORGE / Spirochaetes
Leptonemaillini DSM 21528 / LEPTO / Spirochaetes
Leptospiraalexanderi / LEPTOA / Spirochaetes
LeptospirabiflexaserovarPatocstrain 'Patoc1 (Ames)' / LBF / Spirochaetes
LeptospirabiflexaserovarPatocstrain 'Patoc1 (Paris)' / LEPBI / Spirochaetes
LeptospiraborgpeterseniiserovarHardjo-bovis str. JB197 / LBJ / Spirochaetes
LeptospiraborgpeterseniiserovarHardjo-bovis str. L550 / LBL / Spirochaetes
Leptospirabroomii / LEBRO / Spirochaetes
Leptospirainadai / LEDAI / Spirochaetes
LeptospirainterrogansserovarBulgarica / LEPI / Spirochaetes
LeptospirainterrogansserovarCopenhagenistr. Fiocruz L1-130 / LIC / Spirochaetes
LeptospirainterrogansserovarLaistr. 56601 / LA / Spirochaetes
Leptospirainterrogansserovar Pomona / LICPO / Spirochaetes
Leptospirakirschneri / LEKIR / Spirochaetes
Leptospirakmetyi / LETYI / Spirochaetes
Leptospiranoguchii / LECHII / Spirochaetes
Leptospirasantarosai / LESAN / Spirochaetes
Leptospiraweilii / LEWEI / Spirochaetes
Spirochaetasmaragdinae / SMARA / Spirochaetes
Treponema pallidum / TPADAL / Spirochaetes
Turneriella parva / TURPA / Spirochaetes
Kocuriarhizophila / KOCU / Actinobacteria
Kribbellaflavida DSM 17836 / KRIBBE / Actinobacteria
Mycobacterium tuberculosis / MYCTU / Actinobacteria
Propionibacterium acnes K / PROPIO / Actinobacteria
Streptomycescoelicolor / STRECO / Actinobacteria
Sebaldellatermitidis / SEBAL / Fusobacteria
Streptobacillusmoniliformis DSM 12112 / MONILI / Fusobacteria
Beijerinckia indica / BEIJE / Alpha- proteobacteria
Brucellamelitensis M28 / BRUCE / Alpha- proteobacteria
Caulobactercrescentus / CAULO / Alpha- proteobacteria
Citromicrobiumbathyomarinum / CITROBA / Alpha- proteobacteria* / gi|296284512
Dinoroseobactershibae / DINORO / Alpha- proteobacteria* / gi|159044238
Erythrobacterlitoralis / ERYLITO / Alpha- proteobacteria* / gi|85373171
Gluconacetobacterdiazotrophicus / GLUZO / Alpha- proteobacteria
Granulibacterbethesdensis / GRANU / Alpha- proteobacteria
Novosphingobiumaromaticivorans / NOVOAR / Alpha –proteobacteria* / gi|87199138
Novosphingobiumpentaromativorans / NOVOPEN / Alpha –proteobacteria* / gi|359398457
Pelagibacabermudensis / PELAGI / Alpha -proteobacteria
Puniceispirillummarinum / PUNICE / Alpha- proteobacteria
Rhizobiumleguminosarum / RHIZO / Alpha –proteobacteria* / gi|393168254
Rhodobactersphaeroides / RHODO / Alpha -proteobacteria
Rhodospirillumrubrum / RHORU / Alpha -proteobacteria
Roseomonascervicalis / ROSEO / Alpha –proteobacteria* / gi|296535256
Ruegeriapomeroyi / RUEGE / Alpha –proteobacteria* / gi|56696993
Sphingobiumchlorophenolicum / SPHINCLO / Alpha –proteobacteria* / gi|334345210
Sphingobiumjaponicum / SPHINJA / Alpha –proteobacteria* / gi|294010788
Sphingomonaswittichii / SPHINWI / Alpha –proteobacteria* / gi|148555342
Sphingopyxisalaskensis / SPHINLA / Alpha –proteobacteria* / gi|103486334
Achromobacterarsenitoxydans / ACHRO / Beta-proteobacteria* / gi|359799492
Achromobacterpiechaudii / ACHROPI / Beta-proteobacteria* / gi|400197007
Achromobacterxylosoxidans A8 / AXYLO / Beta-proteobacteria* / gi|311107716
Advenellakashmirensis / ADVENE / Beta-proteobacteria* / gi|389872885
Bordetellapertussis / BORDE / Beta-proteobacteria* / gi|33592951
Bordetellapetrii / BORPE / Beta-proteobacteria* / gi|163857763
Burkholderiapseudomallei / BURKHO / Beta-proteobacteria* / gi|167816495
Burkholderiarhizoxinica / BURHIZO / Beta-proteobacteria* / gi|312796648
Burkholderiaxenovorans / BURXO / Beta-proteobacteria* / gi|91784174
Chromobacteriumviolaceum / CHROMO / Beta-proteobacteria
Neisseriameningitidis / NEIMA / Beta-proteobacteria
Nitrosomonaseutropha / NITRO / Beta-proteobacteria
Nitrosospiramultiformis / NIMU / Beta-proteobacteria
Polynucleobacternecessarius / POLYNO / Beta-proteobacteria* / gi|171463665
Ralstoniaeutropha H16 / RALSTO / Beta-proteobacteria
Desulfobacteriumautotrophicum / DESUAU / Delta-proteobacteria
Geobactersulfurreducens / GEOSU / Delta-proteobacteria
Pelobacterpropionicus / PELOBA / Delta-proteobacteria
Citrobacterfreundii / CIFREU / Gamma-proteobacteria
Escherichia coli. / ECOLI / Gamma-proteobacteria
Francisellanovicida U112 / FRANCI / Gamma-proteobacteria
Haemophilusinfluenzae / HAEMO / Gamma-proteobacteria
Legionelladrancourtii / LEGIDRA / Gamma-proteobacteria* / gi|374262978
Marinobacteradhaerens / MARIAD / Gamma-proteobacteria
Marinobactersp. / MARINO / Gamma-proteobacteria
Pantoeasp. AS-PWVM4 / PANTOEA / Gamma-proteobacteria
Pasteurellamultocida / PASTEU / Gamma-proteobacteria
Pseudomonasaeruginosa / PSEUDO / Gamma-proteobacteria
Pseudomonaschlororaphis / PSEUCHO / Gamma-proteobacteria* / gi|389683838
Pseudomonasentomophila / PENTOMO / Gamma-proteobacteria* / gi|104780072
Pseudomonasfluorescens / PSEUFLU / Gamma-proteobacteria
Psychromonasingrahamii 37 / PSYGRA / Gamma-proteobacteria
Salmonellatyphimurium LT2 / SALMO / Gamma-proteobacteria
Shigellaflexneri / SHIGUE / Gamma-proteobacteria
Vibriocholerae / VICHO / Gamma-proteobacteria
Vibrioparahaemolyticus AQ3810 / VIPARA / Gamma-proteobacteria
Xanthomonasaxonopodis / XANTHO / Gamma-proteobacteria
Yersiniaenterocolitica / YERSINA / Gamma-proteobacteria
Helicobacterpylori / HELPY / Epsilon-proteobacteria
Mycoplasmagallisepticum / MYCOGA / Mollicutes
Mycoplasmapenetrans HF-2 / MYCOPE / Mollicutes
Mycoplasmasynoviae / MYCOSY / Mollicutes
Amsactamooreientomopoxvirus'L'] / AMSACTA / Virus
Anophelesdarlingi / ANOPHE / Eukaryote
Aphrocallistesvastus / APHRO / Eukaryote
Arabidopsislyrata / ARALY / Eukaryote - Viriplantae* / gi|297844924
Arabidopsisthaliana / ARATHA / Eukaryote - Viriplantae* / gi|18394744
Aspergillusnidulans / ASPER / Eukaryote
Camponotusfloridanus / CAMPO / Eukaryote
Daniorerio / DANIO / Eukaryote
Drosophilamelanogaster / DROSO / Eukaryote
Glicinemax / GLIMAX / Eukaryote - Viriplantae* / gi|356510199
Harpegnathossaltator / HARPE / Eukaryote
Homo sapiens / HOMO / Eukaryote
Medicagotruncatula / MEDICAGO / Eukaryote - Viriplantae* / gi|357483447
Physcomitrellapatens / PHYSCO / Eukaryote
Pisumsativum / PISUM / Eukaryote
Populustrichocarpa / POTRI / Eukaryote –Viriplantae* / gi|224082864
Ricinuscommunis / RICINU / Eukaryote - Viriplanae* / gi|255538662
Saccharomycescerevisiae / SACCHA / Eukaryote
Schizosaccharomycespombe / SCHIZO / Eukaryote
Trichodermaatroviride / TRICHO / Eukaryote
Trichomonasvaginalis G3 / TRIVA / Eukaryote
Vitisvinifera / VITIS / Eukaryote - Viriplantae* / gi|302142502
Xenopuslaevis / XENOP / Eukaryote
* indicates the organisms in condensed branches in the Figure 2. The accession codes refer to genes from these organisms in the condensed
branches in this aforementioned phylogenetic tree. Other accession codes are indicated in the Figures.
Table S3- Oligonucleotides employed in this work.
gene ID/LIC a / Nameb / Sequenceoligonucleotide / Amplicon (pb)c / meanefficiencydNR_074524 / 16S-F / TTCAGTTGGGCACTCGTAAG / 97 / 1,970 ± 0,088
16S-R / CGTGTGTTGCCCTAGACATAA
LIC11774 / mutS1-F / AGACAAATCGCCCTCAATCA / 107 / 1,950 ± 0,057
mutS1-R / CCCGCTCCGATTCTAGTAAATAA
LIC13389 / mutS3-F / CGGGTTCGAATATGTCTGGAAA / 76 / 1,998 ± 0,127
mutS3-R / CCACCCGCCATAGAAAGAATAG
LIC13476 / recR-F / CAAACGTTGCGGCTCTTATG / 103 / 1,990 ± 0,070
recR-R / AATGTCTTCCGGTTGCTCTAC
LIC10420 / S-uvrD-F / ACGACAGCCAAGCGATTTA / 121 / 1,965 ± 0,085
S-uvrD-R / TCCGGAAGAGATCGGTAATTTG
LIC13402 / ada-F / TTCTCTCTAAACCTCAAACCACTT / 107 / 2,088 ± 0,162
ada-R / CGGAGTCATCCCTTCAATCTTTA
LIC12677 / DNA lig-F / AGCTCTCTTCAAACCGGAAC / 106 / 1,93 ± 0,026
DNA lig-R / CTGTGTATCCTTTCGCCATCT
LIC11620 / recN-F / GAGAATGTGGGCGGGATGGA / 104 / 1,971 ± 0,062
recN-R / GTTGTGAACTTCGGCGAGCA
LIC11745 / recA-F / TTGATTCTGTGGCGGCTTTGG / 101 / 2,024 ± 0,115
recA-R / TCTAAGCGCCTGGGACATGAG
LIC10238 / alkA1-F / GAAACGCGCAAAATCATTCATGT / 133 / 2,019 ± 0,108
alkA1-R / CAGCCGAAACAACCGATCTACTATT
LIC12305 / lexA1-F / TTGTGGCCTGAACGGGAAGT / 129 / 2,000 ± 0,890
lexA1-R / GGCAAAGGGTGCCTACGATC
LIC13064 / tag-F / GTAATCCAAGAAAGCCCAGCCT / 140 / 2,066 ± 0,160
tag-F / AAACGTTGTGCTTGGGTTACCG
LIC11717 / uvrA-F / GTTTCACAACGTCCACCGCT / 101 / 1,950 ± 0,092
uvrA-R / ACGCCGATCCGAGAGATGTT
LIC12362 / alkA2-F / CCAGTTATGTTCGAGACCTTGC / 132 / 1,977 ± 0,297
alkA2-R / CTACGGTCCAATTTCCAATCCC
aLocus tag of the corresponding gene used for primer design
b F- and R, forward and reverse primer sequences, respectively.
cPCR product size (in base pairs).
dEfficiency for PCR (determined by the software LinRegPCR, as described in Materials and Methods). The data represent the average of the values obtained by LinRegPCR for each reaction. All oligonucleotides had the correlation coefficient squared (R2) superior or equal to 0,998.
Table S4- Putative DNA repair of Leptospiraspp for direct repair. Each ORF is identified by the corresponding locus tag.
Genes / L. biflexa Ames / L. biflexa Paris / L.interrogansCopenhageni / L. interrogans Lai / L.borgpetersenii JB197 / L. borgpetersenii L550phra-like photolyase * / LBF_2420 / LEPBI_I2494 / −−− / −−− / −−− / −−−
photolyase b* / LBF_2340 / LEPBI_I2409 / LIC_11339 / LA_2649 / −−− / −−−
splB / LBF_0608 / LEPBI_I0633 / LIC_10195 / LA_0226 / LBJ_0162 / LBL_2921
ada* / LBF_4131 / LEPBI_II0134 / LIC_13402 / LA_4250 / LBJ_2922 / LBL_0141
alkB / LBF_3071 / LEPBI_I3182 / −−− / −−− / −−− / −−−
atl* / LBF_0549 / LEPBI_I0568 / LIC_10119 / LA_0131 / LBJ_0115 / LBL_2962
* Genes that had their identity confirmed by phylogenetic analysis.
Table S5- Genes encoding putative repair proteins for Excision Repair in Leptospira spp. Each ORF is identified by the corresponding locus tag.
Genes / L. biflexa Ames / L. biflexa Paris / L. interrogansCopenhageni / L. interrogans Lai / L. borgpetersenii JB197 / L. borgpetersenii L550Base excisionrepair
DNA glycomonofunction
alkA * / −−− / −−− / LIC_10238; LIC_12362 / LA_0281; LA_1370 / LBJ_0662 / LBL_2417
alkC / LBF_0595 / LEPBI_I0619 / LIC_11639 / LA_2298 / −−− / −−−
alkD / LBF_2342 / LEPBI_I2411 / LIC_12552; LIC_11252 / LA_1129; LA_2767 / LBJ_1745 / LBL_1964
mutY / LBF_1233 / LEPBI_I1287 / LIC_11614 / LA_2328 / LBJ_1296 / LBL_1521
Tag / −−− / −−− / LIC_13064 / LA_3832 / −−− / −−−
ungorudg * / LBF_0791 / LEPBI_I0821 / LIC_10548; LIC_13102 / LA_3668; LA_3883 / LBJ_2712; LBJ_0598 / LBL_0362; LBL_2482
Bifunctional DNA
glycosylase
endonuclease III (nth) / LBF_0987 / LEPBI_I1021 / LIC_11759 / LA_2163 / LBJ_1856 / LBL_1428
AP endonuclease
exonuclease III (xth) / LBF_1776 / LEPBI_I1829 / LIC_11452 / LA_2516 / LBJ_1669 / LBL_1888
Others
MutT-Nudixmotif / −−− / −−− / LIC_12191 / LA_1589 / −−− / −−−
MutT-Nudixmotif / −−− / −−− / LIC_10257 / LA_0300 / LBJ_2602 / LBL_0510
MutT-Nudixmotif / LBF_0166 / LEPBI_I0171 / LIC_13264 / LA_4093 / LBJ_0192 / LBL_2891
MutT-Nudixmotif / pseudo / LEPBI_I2583 / LIC_20067 / LB_085 / pseudo / LBL_0941
MutT-Nudixmotif / LBF_2015 / LEPBI_I2068 / LIC_12589 / LA_1082 / LBJ_2308 / LBL_0799
MutT-Nudixmotif / LBF_3172 / LEPBI_I3287 / LIC_10106 / LA_0119 / LBJ_0097 / LBL_0038
MutT-Nudixmotif / LBF_3212 / LEPBI_I3326 / LIC_13180 / LA_3977 / LBJ_0418 / LBL_2659
Nucleotideexcisionrepair
uvrA / LBF_1784 / LEPBI_I1837 / LIC_11717 / LA_2212 / LBJ_1403 / LBL_1629
uvrB / LBF_0814 / LEPBI_I0845 / LIC_12941 / LA_0649 / LBJ_2353 / LBL_0755
uvrC / LBF_2022 / LEPBI_I2076 / LIC_11756 / LA_2166 / LBJ_1853 / LBL_1431
mfd / LBF_1770 / LEPBI_I1823 / LIC_11455 / LA_2513 / LBJ_1666 / LBL_1885
uvrD * / LBF_1683 / LEPBI_I1736 / LIC_11732 / LA_2193 / LBJ_1356 / LBL_1581
pcrA * / LBF_1584 / LEPBI_I1634 / LIC_11624 / LA_2317 / LBJ_1306 / LBL_1531
repA * / LBF_2013 / LEPBI_12066 / LIC_12588 / LA_1085 / LBL_2305 / LBL_0802
smalluvrD * / LBF_2310 / LEPBI_I237 / LIC_10420 / LA_0488 / −−− / −−−
Mismatchrepair
mutL / LBF_2096 / LEPBI_12151 / LIC_12514 / LA_1175 / LBJ_2225 / LBL_2218
mutS1 / LBF_0802 / LEPBI_I0833 / LIC_11774 / LA_2146 / LBJ_1867 / LBL_1417
mutS3 ** / LBF_0324 / LEPBI_I0334 / LIC_13389 / LA_4235 / LBJ_2911 / LBL_0152
Dam / −−− / −−− / −−− / −−− / LBJ_1937 / LBL_1347
* Genes that had their identity confirmed by phylogenetic analysis. Bold: Genes possibly obtained by LGT events. **Genes specific to Leptospiraceae.
Table S6-Putative proteins related to recombinational repair in Leptospira spp.Each ORF is identified by the corresponding locus tag.
Saprophytic / Pathogen / Host-dependentGenes / L. biflexa Ames / L. biflexa
Paris / L. interrogansCopenhageni / L. interrogans
Lai / L. borgpetersenii JB197 / L. borgpetersenii L550
HR
recA / LBF_2374 / LEPBI_I2446 / LIC_11745 / LA_2179 / LBJ_1344 / LBL_1569
recB / LBF_5019 / LEPBI_p0020 / LIC_12686 / LA_0966 / LBJ_0684 / LBL_2395
recC / LBF_5020 / LEPBI_p0021 / LIC_12688 / LA_0965 / LBJ_0685 / LBL_2394
recD / LBF_5018 / LEPBI_p0019 / LIC_12685 / LA_0967 / LBJ_0683 / LBL_2396
recF / LBF_0006 / LEPBI_I0003 / LIC_10003 / LA_0003 / LBJ_0006 / LBL_0006
recG / LBF_0338 / LEPBI_I0349 / LIC_13150 / LA_3945 / LBJ_0400 / LBL_2677
recJ / LBF_1255 / LEPBI_I1309 / LIC_11066 / LA_2999 / LBJ_1989 / LBL_1061
Reco / LBF_2037 / LEPBI_I2091 / LIC_12104 / LA_1685 / LBJ_1202 / LBL_1254
recR / LBF_3348 / LEPBI_I3463 / LIC_13476 / LA_4333 / LBJ_3003 / LBL_0066
recQ / LBF_0300 / LEPBI_I0309 / LIC_12961 / LA_0625 / LBJ_0296 / LBL_2780
recS / LBF_2428 / LEPBI_I2503 / LIC_12689 / LA_0964 / LBJ_0686 / LBL_2393
ruvA / LBF_1447 / LEPBI_I1501 / LIC_11148 / LA_2903 / LBJ_1987 / LBL_1063
ruvB / LBF_0505 / LEPBI_I0524 / LIC_12811 / LA_0810 / LBJ_0761 / LBL_2317
ruvC / LBF_3203 / LEPBI_I3318 / LIC_12885 / LA_0723 / LBJ_0544 / LBL_2536
ssb1 / LBF_2873 / LEPBI_I2975 / LIC_10564 / LA_3645 / pseudo / LBL_2444
ssb2 / LBF_2045 / LEPBI_I2099 / LIC_12112 / LA_1676 / LBJ_1194 / LBL_1246
SMC
recN / LBF_1580 / LEPBI_I1630 / LIC_11620 / LA_2321 / LBJ_1302 / LBL_1527
mre11 / LBF_2807 / LEPBI_I2906 / LIC_10252 / LA_0294 / LBJ_0659 / LBL_2420
rad50 / LBF_2806 / LEPBI_I2905 / LIC_10251 / LA_0293 / LBJ_0658 / LBL_2421
NHEJ
ATP dependentligase / −−− / −−− / LIC_12677 / LA_0984 / −−− / −−−
Bold: Genes possibly obtained by LGT events.
Table S7- Leptospiraspp genes related to DNA damage tolerance. Each ORF is identified by the corresponding locus tag.
Genes / L. biflexa Ames / L. biflexaParis / L. interrogansCopenhageni / L. interrogansLai / L. borgpetersenii JB197 / L. borgpetersenii L550
Y-family TLS
dinP / LBF_4145 / LEPBI_II0150 / LIC_13052 / LA_0503 / −−− / −−−
B-family
DNA pol II / LBF_2104 / LEPBI_I2161 / −−− / −−− / −−− / −−−
Bold:possibly obtained by LGT events.
1