Materials and Methods
Construction of the lentiviral expression vector Lenti6.3-ChABC-3F
We chose pLenti6.3_MCS as a gene delivery vector in this expression study of ChABC-3F, which has high transfection efficiency in BMSCs cells (Tang, et al. 2013). The ChABC-3F gene without the bacterial leader sequence(aa 1-24)is derived from the previously published pCAGIP-ChABC-3F plasmid(Kluppel 2011). First, the fragment containing ChABC-3F gene was excised from pCAGIP-ChABC-3F plasmid constructed previously by the following primers:
ChABC-pacI-F / GCCTTAATTAAGCCACCATGGCTACCTCTAATC;ChABC-AscI-R / ATTGGCGCGCCCTTGTCATCGTCATCCTTGTAATC.
Subsequently it was cloned into pLenti6.3_MCS vector (Invitrogen, China), digested by pacI and AscI to generate pLenti6.3-ChABC-3F. All necessary plasmid constructs were amplified in DH5α cells (Transgen, China). To ensure the ChABC-3F sequence of the pLenti6.3-ChABC-3F plasmid was completely consistent with the original sequence of plasmid pCAGIP-ChABC-3F, sequencing with the following primers was used:
CMV / CGCAAATGGGCGGTAGGCGTG;V5-R / ATCGAGACCGAGGAGAGG.
Generation of recombinant Lenti6.3-ChABC-3F lentivirus particles was performed in HEK293T cells (Invitrogen, China), by using packaging mix system and Lipofectamine 2000 (Invitrogen, China) according to the manufacturer’s instructions. Restriction enzymes and DNA ligase were purchased from NEB, England. Thereafter, culture supernatants (containing viralparticles) from HEK293T cells were collected by centrifugation and filtered with a 0.45um filter. Viral stock was further enriched by ultra-centrifugation at 50000g for 2hs, re-suspended inopti-MEM, and then stored at −80°C after titer determination. Finally, physical titer of the lentivirus was detected by real time quantitative - polymerase chain reaction (QRT-PCR) (described below).
hBMSCs culture
Human bone marrow was harvested from three healthy volunteer donors (aged 20，20, 52 years，male), after obtaining informed consent per the guidelines of the Zhujiang Hospital Medical Ethics Committee. hBMSCs were obtained, cultured and characterized using methods described in our previous work(Chen, et al. 2008; Tang, et al. 2013). Briefly, about 10 ml bone marrow was aspirated from each donor by anterior superior iliac spine puncture. Mononuclear cells were separated by Ficoll density gradient centrifugation, then cultured at 105/mlin DMEM-LG (Invitrogen)supplemented with 10% fetal bovine serum (HyClone). nonadherentcellswere discarded two days later, and the remaining adherent cells werepassaged to the third generation (passage 3).
Transfection, establishment of stable cell clones
The passage 3 (P3)hBMSCs were transfected with either Lenti6.3-ChABC-3F expression vector or the naked Lenti6.3 vector without ChABC-3F sequence inserted. The optimal multiplicity of Infection (MOI) was assessed by the relationship between the relative ChABC gene expression and the cell survival rate. Relative ChABC gene expression was detected usingthe QRT-PCR (described below). And the cell survival rate was determined by the MTT assay at 72 hrs after transfection. The tested MOI level was 100, 500 and 1000, respectively. Lentivirus was added into 37°C pre-heated DMEM-F12containing 2% FBS, 8 mg / LPolybrene (Sigma, H9268) and 5 mg/LBlasticidin (Invitrogen, R210-01). 12 hours after infection, culture medium was changed to DMEM-F12 plus10% FBS and 5 mg/LBlasticidin. After another 2 days of culture, cell precipitates and supernatant conditioned media were collected respectively for further experiments. For establishing stable cell clones,cells were maintained in medium with 5 mg/l Blasticidin.
QRT-PCR
Total RNA of the Lenti6.3-ChABC-3F transfectedhBMSCs and control cells were extracted with TRIzol (Invitrogen, 15596-018). After purified, total RNA (1µg) was reverse-transcribed into cDNA in a total volume of 20 μl per well reverse transcriptase reaction system containing reagents from Promega. Real-time PCR was performed with the ABI PRISM® 7500 Sequence Detection System (Applied Biosystems，ABI-7500). Using 20 ng cDNA as a template and the SYBR® Green Realtime PCR Master Mix (Toyobo, QPK201), ChABC, and GAPDH genes as the internal reference, were amplified.TheprimersforChABC,ChABC - F: TGA CGC AAG GTA CCA ATG GA andChABC - R: TCG GAC TTG AGC TTG CTG AT; and for GAPDH, GAPDH – F: GAA GGT CGG AGT CAA CGG ATT and GAPDH – R: CGC TCC TGG AAG ATG GTG AT. The relative expression level of ChABC mRNA [CT (threshold cycle)] was determined by normalized against the expression level of GAPDH with Genex Professional software version 4.3.8 (MultiD Analysis AB, Göteborg, Sweden).
Western blotting
The transfected hBMSCsand the non-transfectedhBMSCswere rinsed with phosphate-buffered saline (PBS) twice, and then lysed in lysis buffer (containing a protease inhibitor cocktail (complete Mini, Roche Applied Science) and a phosphatase inhibitor cocktail (PhosSTOP, Roche Applied Science) in 50 mM Tris HCl, 150 mM NaCl, 0.5% sodium deoxycholate, 1%Triton X-100, 0.1% SDS and 1 mM EDTA. After sonication, lysates was centrifuged (14,000 rpm for 15 minutes at 4°C). Thereafter the supernatant was collected.
Supernatant conditioned medium samples were collected and concentrated by a Amicon Ultra -15 Centrifugal Filter Units ultrafiltration device (Milliplex, 30K NMWL, UFC903024), and then centrifuged (3,000rpm for 20 minutes at 4°C). Repeat concentration three times. The protein content was quantified by a BCA protein assay kit (KeyGEN, KGPBCA).
Thereafter, equal amounts of the samples were separated by electrophoresis on 8% SDS–polyacrylamide gels and transferred onto polyvinylidene fluoride (PVDF) membranes(Millipore, USA). The membranes were blocked with 5% nonfat milk in Tris buffered saline plus 0.1% Tween for 1 h at room temperature. Primary antibodies (Anti-Flag-M2 antibody (Sigma, F1804, 1:1000 )，ChABC Antibody(1E10) (NOVUS, NBP1-96141B, 1:200) were applied overnight at 4°C. After rinsed three times with TBST, the membrane was then incubated with secondary polyclonal rabbit anti-mouse IgG (H+L) (Southern Biotech, 6170-05, 1: 4 000) antibody for 1 h at room temperature. Commercialized ChABC (Sigma, USA) was used as a positive control.β-actin was used as the loading control. Immunoreactive proteins were detected by enhanced chemiluminescence (Pierce). Image J (1.42) was used for protein bands quantitative determination.
Immunofluorescence
hBMSCs with or withoutLenti6.3-ChABC-3F transfection were seeded in 24-well plate coated with gelatin. After culture were 80% confluent, cells were washed with PBS three times and then fixed with 4% paraformaldehyde for 10 min. No permeabilization was performed to avoid intracellular signals. Subsequently, cells were incubated with a mouse monoClonal anti-Flag-M2 antibody (Sigma, F1804, 1:1000 in PBS/10% normal goat serum) overnight at 4°c after blocking with 10% normal goat serum for 30 min at room temperature. After three washes with PBS, cells were incubated with a goat anti-mouse IgG F(ab′) 2 fragment–FITC antibody (sigma，F8521, 1:100 in PBS) for 1 h at room temperature in the dark. Nuclei were counterstained with 0.5 µg/ml DAPI (Sigma，D9564). Fluorescence images were captured with a Leica fluorescent microscope.
ELISA analysis
The secretion of ChABC-3F was further determined by enzyme-linked immunosorbent assay (ELISA)withChABCantibody pair (Novus, NBP1-97919) according to the instruction manual. In brief, 96-well plates(Corning) were coated with diluted capture antibody. After washed the plates, blocking Buffer (2%BSA-PBS) was added to block non-specific binding and reduce background. Appropriate standard dilutions of commercialChABC (Sigma, C2905) were prepared for different concentrations, ranging from80ng/ml to 1.25ng/ml, and 0ng/ml. 100μl of series standard dilutions and the cell culture supernatant was incubated with the capture antibody for 2 hours at ambient temperature. The standard curve was marked to determine the concentration ChABC-3F in cell culturesupernatant. ChABC-3F in supernatant was detected with 1μg/ml detection antibody. 150μl of colorimetric substrate solution was added to each well after the reaction of horseradish peroxidase substrate. Sufficient colorimetric reaction was developedfor 10 min at ambient temperature in the dark. Absorbance value was read at a wavelength of 492 nm. All samples were measured in triplicate.
ChABC-3F activity analysis and thermal stability analysis
Activity and thermal stability of ChABC-3F protein in conditioned medium was detected by the methods as previous report(Kluppel 2011). First, the conditioned media were collected and filtered with 0.22μm membrane. Then, confluent NIH3T3 cells, which contains abundant CSPGs, were pre-incubated with the conditioned media or commercially available chABC, and thenfixed with 4% paraformaldehyde for 10 min after a rinse with PBS. Cells were incubated with a mouse monoclonal anti-C4S antibody (mab2030, Millipore; 1:300 in 10% normal goat serum) overnight at 4°C after blocking with 10% normal goat serum for 30 min at room temperature. Samples were washed with PBS three times, and then incubated with a goat anti-mouse IgG F(ab′)2 fragment–FITC antibody (sigma，F8521, 1:100 in PBS) for 1 h at room temperature in the dark. Cells were washed three times followed by incubated with DAPI (0.5ug/ml in PBS) for 10 min. Images were captured and analyzed using a Leica fluorescent microscope.
For analysis of thermal stability, the conditioned media were stored at 4°C or -20°C four months，or pre-incubated at 37°C (for 0h、16h、24h、40h, respectively) before added to NIH3T3 cells culture. Immunofluorescent detection of digested chondroitin sulfates was performed as described above.
ChABC-3F expressionin transfected hBMSCs after long-term culture in vitro
hBMSCs were cultured for a long time in vitro, and detection of ChABC-3F was also performed on the passage 10 cells. The observation included ChABC-3F expression in hBMSCs by immunofluorescent detection, ChABC-3F in conditioned media by ELISA detection, and enzyme activity of the conditioned media by anti-C4S immunofluorescent detection. Methods in details were described as above.
Statistical analysis
All the data are presented as the mean ± standard error (SE). The one-way ANOVA was applied to test the difference between groups. p<0.05 was considered to indicate a significant difference.
Chen ZZ, Jiang XD, Zhang LL, Shang JH, Du MX, Xu G, Xu RX (2008) Beneficial effect of autologous transplantation of bone marrow stromal cells and endothelial progenitor cells on cerebral ischemia in rabbits. Neuroscience letters 445:36-41
Kluppel M (2011) Efficient secretion of biologically active Chondroitinase ABC from mammalian cells in the absence of an N-terminal signal peptide. Molecular and cellular biochemistry 351:1-11
Tang H, Xiang Y, Jiang X, Ke Y, Xiao Z, Guo Y, Wang Q, Du M, Qin L, Zou Y, Cai Y, Chen Z, Xu R (2013) Dual expression of hTERT and VEGF prolongs life span and enhances angiogenic ability of aged BMSCs. Biochemical and biophysical research communications 440:502-508